ID: 1185079823

View in Genome Browser
Species Human (GRCh38)
Location 22:48703515-48703537
Sequence ACAGTCCCAGTGAGCTCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 206}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185079810_1185079823 5 Left 1185079810 22:48703487-48703509 CCCAGATCCCTCCCCCATCCTCA 0: 1
1: 1
2: 4
3: 48
4: 553
Right 1185079823 22:48703515-48703537 ACAGTCCCAGTGAGCTCTGGTGG 0: 1
1: 0
2: 1
3: 19
4: 206
1185079809_1185079823 6 Left 1185079809 22:48703486-48703508 CCCCAGATCCCTCCCCCATCCTC 0: 1
1: 1
2: 8
3: 86
4: 833
Right 1185079823 22:48703515-48703537 ACAGTCCCAGTGAGCTCTGGTGG 0: 1
1: 0
2: 1
3: 19
4: 206
1185079816_1185079823 -8 Left 1185079816 22:48703500-48703522 CCCATCCTCAGCCCCACAGTCCC 0: 1
1: 0
2: 3
3: 77
4: 545
Right 1185079823 22:48703515-48703537 ACAGTCCCAGTGAGCTCTGGTGG 0: 1
1: 0
2: 1
3: 19
4: 206
1185079812_1185079823 -2 Left 1185079812 22:48703494-48703516 CCCTCCCCCATCCTCAGCCCCAC 0: 1
1: 4
2: 22
3: 343
4: 3220
Right 1185079823 22:48703515-48703537 ACAGTCCCAGTGAGCTCTGGTGG 0: 1
1: 0
2: 1
3: 19
4: 206
1185079817_1185079823 -9 Left 1185079817 22:48703501-48703523 CCATCCTCAGCCCCACAGTCCCA 0: 1
1: 0
2: 5
3: 94
4: 762
Right 1185079823 22:48703515-48703537 ACAGTCCCAGTGAGCTCTGGTGG 0: 1
1: 0
2: 1
3: 19
4: 206
1185079814_1185079823 -6 Left 1185079814 22:48703498-48703520 CCCCCATCCTCAGCCCCACAGTC 0: 1
1: 0
2: 12
3: 111
4: 997
Right 1185079823 22:48703515-48703537 ACAGTCCCAGTGAGCTCTGGTGG 0: 1
1: 0
2: 1
3: 19
4: 206
1185079813_1185079823 -3 Left 1185079813 22:48703495-48703517 CCTCCCCCATCCTCAGCCCCACA No data
Right 1185079823 22:48703515-48703537 ACAGTCCCAGTGAGCTCTGGTGG 0: 1
1: 0
2: 1
3: 19
4: 206
1185079811_1185079823 4 Left 1185079811 22:48703488-48703510 CCAGATCCCTCCCCCATCCTCAG 0: 1
1: 0
2: 6
3: 60
4: 648
Right 1185079823 22:48703515-48703537 ACAGTCCCAGTGAGCTCTGGTGG 0: 1
1: 0
2: 1
3: 19
4: 206
1185079815_1185079823 -7 Left 1185079815 22:48703499-48703521 CCCCATCCTCAGCCCCACAGTCC 0: 1
1: 0
2: 4
3: 87
4: 666
Right 1185079823 22:48703515-48703537 ACAGTCCCAGTGAGCTCTGGTGG 0: 1
1: 0
2: 1
3: 19
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185079823 Original CRISPR ACAGTCCCAGTGAGCTCTGG TGG Intronic
900130238 1:1084284-1084306 CCAGTCCCAGGGTGCTCTGTGGG - Intronic
900375280 1:2351414-2351436 AAAGTCCCAGAGAGGGCTGGCGG - Intronic
900465192 1:2822029-2822051 GCAGTCGCCGTGAACTCTGGAGG - Intergenic
900701860 1:4053499-4053521 AGAGTCCAGGTGAGCTCTGAGGG + Intergenic
901791518 1:11655678-11655700 ACCGCCCCAGTGACCCCTGGAGG + Exonic
902097749 1:13960559-13960581 GCAGCCACAGTGACCTCTGGTGG + Intergenic
904326341 1:29729041-29729063 AGAGGCCCAGGCAGCTCTGGAGG + Intergenic
904424114 1:30412721-30412743 GCAGTTCCGCTGAGCTCTGGAGG - Intergenic
904433182 1:30478373-30478395 AGAGGCCCAGGCAGCTCTGGAGG - Intergenic
908875410 1:68668714-68668736 ACAGTTCCAGAGGGCTGTGGAGG - Intergenic
909431298 1:75590480-75590502 ACAGCACCAGTGAGCTCTTGGGG + Intronic
910019161 1:82565393-82565415 CCAGGCCCAGTGTCCTCTGGTGG + Intergenic
910498142 1:87856512-87856534 TTATTCCCAGTGAGTTCTGGAGG + Intergenic
913322183 1:117596537-117596559 ACAGTCCCTGTGACCTCACGTGG + Intergenic
917088449 1:171327846-171327868 GCAGTTACAGTGAGCTCTGATGG + Intronic
917217532 1:172693288-172693310 AAAGTCCCAGTGAGCCCCAGAGG - Intergenic
920416005 1:205799789-205799811 ACACACCCAAGGAGCTCTGGCGG - Exonic
1064559036 10:16577541-16577563 AAAGTGCCAGTGTGCACTGGTGG - Intergenic
1067203361 10:44193956-44193978 ACAGTCCCAGGGAGGGCAGGTGG - Intergenic
1071352823 10:84763581-84763603 ACTCTCCCTGTTAGCTCTGGTGG - Intergenic
1074071809 10:110078797-110078819 ACTGTCCCTTTGAACTCTGGAGG + Intronic
1074556470 10:114495820-114495842 ACAGTCACAGTTAGAACTGGTGG + Intronic
1074786163 10:116843271-116843293 ACAGTATCAGTGAGCTTTTGAGG - Intergenic
1075864850 10:125709025-125709047 AAAGTTCCTCTGAGCTCTGGGGG - Intergenic
1076498111 10:130912523-130912545 ACAGTCGCAGAGAGCCCTGCTGG - Intergenic
1077352744 11:2100440-2100462 ACCCTCGCAGTGAGCTCCGGTGG - Intergenic
1077980455 11:7294667-7294689 TCAGTCCCAGTGAGCCTGGGGGG - Intronic
1078343205 11:10516680-10516702 CCAGGCCCAGTGAGCTTTAGGGG - Intronic
1078926461 11:15879907-15879929 ACAGGACCAGGGAGCTCTGCAGG + Intergenic
1079024269 11:16933708-16933730 ACAAAGCCAGTGAGCTATGGTGG + Intronic
1079754101 11:24234580-24234602 ACAGTGCCAGTGATTTCAGGTGG - Intergenic
1081523705 11:43908231-43908253 TCAGTCTCAATGAGCTCTGAAGG - Intronic
1081646750 11:44795531-44795553 ATAGTCCAAGCGAGTTCTGGCGG + Intronic
1082162556 11:48900775-48900797 CCACGCCCAGGGAGCTCTGGGGG + Intergenic
1082243279 11:49892369-49892391 CCAGGCACAGGGAGCTCTGGGGG + Intergenic
1083612778 11:64012037-64012059 ACAGTCCCAGCAAGTGCTGGCGG + Intronic
1084881228 11:72172982-72173004 ACTGTGCCATTGAGCTCTGTGGG - Intergenic
1086525556 11:87722130-87722152 ACATTCAAAGTGAGCTCTGAGGG + Intergenic
1087342823 11:96930178-96930200 GTAGTCCCAGCGAACTCTGGAGG - Intergenic
1087758700 11:102082309-102082331 AAAGTTGCAGTGAGCTGTGGTGG + Intronic
1098808356 12:75050715-75050737 ACATTCCCATTGGGTTCTGGTGG - Exonic
1101961283 12:109252212-109252234 ACATTCCCATTGGTCTCTGGTGG + Intronic
1104732168 12:131113391-131113413 GGGGTCCCAGTGAGCACTGGAGG + Intronic
1104979752 12:132568559-132568581 AATGTCCCAGTGAGGGCTGGAGG + Intronic
1106483414 13:30153832-30153854 AGAACCCCAGTGAGTTCTGGAGG + Intergenic
1108380650 13:49850819-49850841 TCAGCCCCAGTTAGCTCTGAGGG - Intergenic
1108521451 13:51250579-51250601 ACCCTCCCTGTGATCTCTGGCGG - Intronic
1113538357 13:111085604-111085626 AAAGCCACAGTGAGCTATGGTGG + Intergenic
1114130741 14:19788799-19788821 ATAATTCCAGTGGGCTCTGGAGG + Intronic
1118888680 14:69888509-69888531 TCAGTCCCAGTGCTCCCTGGTGG - Intronic
1119544134 14:75459562-75459584 ACACTCCCAGCATGCTCTGGGGG - Intronic
1119992854 14:79218962-79218984 ATAGTCCCAGTGAGATATGATGG + Intronic
1120053903 14:79899797-79899819 ACAGTCCATGTGGGCTGTGGGGG - Intergenic
1120477426 14:85005993-85006015 AAAGTTCCTTTGAGCTCTGGGGG + Intergenic
1123573795 15:21644430-21644452 ATAATTCCAGTGGGCTCTGGAGG + Intergenic
1123610413 15:22087015-22087037 ATAATTCCAGTGGGCTCTGGAGG + Intergenic
1123673560 15:22685403-22685425 CCACTCCCAGTGGGCTCTGCTGG - Intergenic
1124325562 15:28758395-28758417 CCACTCCCAGTGGGCTCTGCTGG - Intergenic
1124878877 15:33623061-33623083 GAAGTCCCAGTGAGCACTGCAGG + Intronic
1127668412 15:61171403-61171425 ACAGACCTACTGAACTCTGGGGG - Intronic
1128793938 15:70451286-70451308 AAAGCACCAGGGAGCTCTGGTGG + Intergenic
1128879087 15:71226626-71226648 AGAGGCCCAGTCAGCTCTAGGGG - Intronic
1132205621 15:99984230-99984252 TCAGTCCCCAAGAGCTCTGGAGG - Intronic
1202982660 15_KI270727v1_random:378769-378791 ATAATTCCAGTGGGCTCTGGAGG + Intergenic
1133739751 16:8642056-8642078 TCAGTCCCAGTGAGAGTTGGTGG + Intronic
1137236919 16:46624572-46624594 CCAGTCCCAGCGGGGTCTGGGGG + Intergenic
1137575790 16:49599375-49599397 ACAGTCCCAGGGAACACTGAGGG - Intronic
1141539819 16:84711367-84711389 ACAGTTACACTGAGCTGTGGGGG - Intronic
1141593749 16:85085339-85085361 GCAGTGCCAGTGACCTCTCGTGG + Intronic
1141923745 16:87153550-87153572 ACATCCCCAGTGGGGTCTGGGGG - Intronic
1142614180 17:1125404-1125426 CCAGTCCCTGGCAGCTCTGGTGG - Intronic
1143322287 17:6075899-6075921 CCAGTCCCAGTGGGCTGGGGCGG + Intronic
1143644919 17:8223839-8223861 AGAGTCCCAGCAAGATCTGGTGG + Intergenic
1144748876 17:17634494-17634516 ACAGTCACACTGAGATCTAGAGG + Intergenic
1145032583 17:19516199-19516221 AAGGTCCCAGTGAGCTCTGACGG - Intronic
1146977737 17:37130003-37130025 ACAGAGGCAGTGAGCTGTGGTGG + Intronic
1149379893 17:56082850-56082872 CCTGTCCCAGTGAGCTCTCCAGG + Intergenic
1150321334 17:64216921-64216943 ACTGTCTGAGTGAGCCCTGGAGG - Intronic
1151539663 17:74758600-74758622 ATAGCCCCAGTGAGTTCCGGAGG - Intronic
1152121129 17:78419394-78419416 AGATTCCCAGGGTGCTCTGGTGG - Intronic
1153985888 18:10350686-10350708 ACAGTCCCAGAGAGGCCTGGGGG + Intergenic
1157001203 18:43527748-43527770 GCTGTTCCAGTTAGCTCTGGGGG + Intergenic
1157328602 18:46686725-46686747 ACAGGCCCAGTGAGCCAAGGCGG + Intronic
1157443699 18:47729384-47729406 CCAGGGCCACTGAGCTCTGGAGG - Intergenic
1157562614 18:48659501-48659523 ACAGCTCCAGGGAGCCCTGGGGG - Intronic
1157582413 18:48781286-48781308 ACATTTCCAGGGAACTCTGGGGG + Intronic
1157739900 18:50083191-50083213 ACAGTCTCTGTGAGCTCTCTGGG + Intronic
1158726187 18:59975004-59975026 ACAGACCCAGTGAGTGCTGCTGG + Intergenic
1168357832 19:55713499-55713521 ACACTACCAGTGTCCTCTGGTGG - Intronic
925385916 2:3461667-3461689 ATAGTCCCACTGAGGTCAGGTGG + Intronic
925415463 2:3667191-3667213 ACACGCTCAGTGAGCTCTGCGGG - Intronic
925748873 2:7069260-7069282 CCAGTCCCAGCCAGCACTGGAGG - Intergenic
926098965 2:10101629-10101651 AGAGTCACTGTGAGCTTTGGGGG + Intergenic
929058871 2:37903167-37903189 AAAGTTCCCCTGAGCTCTGGGGG + Intergenic
930206964 2:48597361-48597383 ACAGTCCCAGTGAAGTTAGGTGG + Exonic
931117679 2:59182321-59182343 ACAGTCCCTTTCAGCTCTGCGGG - Intergenic
933057152 2:77684655-77684677 ACAGTCCATGTGAGGTCTGAGGG - Intergenic
933927283 2:87105794-87105816 ACAGTCCATGTGAGGTCTGAGGG - Intergenic
936246852 2:110836100-110836122 AGAGACCCAGTGAGCTGTGGTGG + Intronic
937198088 2:120178099-120178121 ACTGTCCCACTCAGCTCTGCTGG + Exonic
937853816 2:126658236-126658258 CCAGTGCCAGTGACATCTGGAGG - Intronic
938644731 2:133318992-133319014 CCAGGCCCACTGAACTCTGGGGG + Intronic
939380063 2:141423666-141423688 ACAGGCACAGTGAGTTCTGGGGG - Intronic
941237750 2:162996125-162996147 GCTGTCCCAGTGGGCCCTGGGGG + Intergenic
941961303 2:171256409-171256431 AAAGTTCCTCTGAGCTCTGGGGG - Intergenic
946903610 2:224395458-224395480 ACAGTGTCAGTGTGTTCTGGGGG - Intronic
947142275 2:227030565-227030587 ACACTCCCAGGGAGGCCTGGAGG + Exonic
947621550 2:231594178-231594200 AGGGTCCCAGGGATCTCTGGAGG - Exonic
947964209 2:234265728-234265750 AGAGTTCCTGTGAGCTCTGGGGG - Intergenic
948699823 2:239752574-239752596 ACAGGGCCAGTGTGCTCTCGGGG - Intergenic
1170891800 20:20382245-20382267 ACAGTCTCACACAGCTCTGGGGG - Intergenic
1171026145 20:21632333-21632355 ACAGTTCCTGTCAGCTCTGTTGG - Intergenic
1171195900 20:23199126-23199148 ACATTTCCAGTGAGCCCTAGGGG + Intergenic
1172080484 20:32336940-32336962 ACAGTTACAGTGAGATCTAGAGG + Intergenic
1174480661 20:50828969-50828991 ACTGTCCCAGTGAGCAAAGGAGG + Intronic
1174499974 20:50977175-50977197 ATAATTTCAGTGAGCTCTGGGGG + Intergenic
1177854356 21:26384527-26384549 ACAGTTCCAGAGAGCTGGGGAGG - Intergenic
1178757006 21:35360909-35360931 ACAGAAACAGTTAGCTCTGGAGG - Intronic
1180661902 22:17475097-17475119 ACAGTGACAGTGAGCACTGGTGG + Intronic
1180694791 22:17744726-17744748 ACAGTCCCTGCCATCTCTGGCGG - Intronic
1180797635 22:18614399-18614421 AAAGTCGCAGTGAGCTGTGATGG + Intergenic
1182034081 22:27183924-27183946 ACAGTCCCAGTGAGGACTGCCGG + Intergenic
1182038925 22:27221006-27221028 ACAGACCAAGTGGGCTCTGGAGG - Intergenic
1182082225 22:27537636-27537658 GCAGTCCCTGTGACCCCTGGAGG - Intergenic
1182617866 22:31600653-31600675 TCAGTCTCAGTGAGCTGAGGAGG - Intronic
1183713954 22:39522760-39522782 ACATTTCCTGTGAGATCTGGGGG + Intergenic
1184233743 22:43172067-43172089 ACAGCCCCACTGAGCTGGGGTGG + Intronic
1185079823 22:48703515-48703537 ACAGTCCCAGTGAGCTCTGGTGG + Intronic
1185081093 22:48709765-48709787 ACAGACCCTGTGAGAGCTGGCGG + Intronic
1185310848 22:50153490-50153512 AGCTGCCCAGTGAGCTCTGGAGG + Intronic
950474605 3:13207478-13207500 ACATTGCCAGAGTGCTCTGGCGG - Intergenic
951526019 3:23653773-23653795 AAAGTCACTGTGAGCTTTGGAGG - Intergenic
952875641 3:37942062-37942084 CATGTCCCAGTGAGCTCTGCTGG - Intronic
953058070 3:39404227-39404249 AAAGTTCCTGTGAGCTCTGGGGG - Intergenic
953311502 3:41884975-41884997 ACAGTCCCAGCTAGCTGGGGGGG - Intronic
953861452 3:46547281-46547303 TCAGTCCCAGTGAGCTGCGCTGG + Intronic
954002521 3:47568969-47568991 AAATCCCCAGAGAGCTCTGGAGG - Intronic
954850244 3:53593883-53593905 GCAGTCCCAGCCAGCTCTGCAGG + Intronic
958647463 3:96890796-96890818 ACATTCCCAGTCAGATGTGGTGG + Intronic
961750038 3:129089269-129089291 CCAGTCCCAGCGGGGTCTGGGGG + Exonic
962395369 3:135011028-135011050 AGAGCACCAGTGAGCTATGGAGG - Intronic
962411570 3:135145658-135145680 ACAATCCCAGTGAGATGGGGAGG + Intronic
966093673 3:176172209-176172231 ACAGTCCCACTGACCTCAAGGGG + Intergenic
967217498 3:187222970-187222992 AAAGTCCCATTGAACTTTGGAGG + Intronic
967864045 3:194175747-194175769 ACAGGGCCAGTCAGCGCTGGTGG + Intergenic
968765182 4:2464584-2464606 AAAGCCCCTCTGAGCTCTGGGGG + Intronic
968883279 4:3312566-3312588 ACAGGCCCAGTTAGCTCAGGAGG - Intronic
969554030 4:7893944-7893966 ACAGCCTCAGCGAGCCCTGGAGG + Intronic
969883733 4:10196936-10196958 ATAGGCACAGTGGGCTCTGGTGG - Intergenic
972219220 4:36935421-36935443 ACAGTCCCAGTAAGATGAGGTGG - Intergenic
973009688 4:45057184-45057206 GCAGTCTCACTGAGCTCAGGAGG + Intergenic
974103315 4:57440968-57440990 ACGGTCCCATCCAGCTCTGGAGG - Intergenic
974196753 4:58585192-58585214 TCTGTCCCAGGGGGCTCTGGTGG + Intergenic
977647512 4:99430554-99430576 ACAGTCCTAGAGAGCTCTTATGG + Intronic
980918220 4:139054573-139054595 GCAGTTCCAGTGAGGTGTGGTGG - Intronic
983996624 4:174190190-174190212 ATGGGTCCAGTGAGCTCTGGCGG + Intergenic
985491373 5:181706-181728 ACAGGCCCAGTGCCCTCTGCAGG - Intronic
985671957 5:1211245-1211267 ACAGTCCCAGCGAGCAGTGAGGG - Intronic
985728357 5:1527282-1527304 CCAGCCCCAGGGAGCTGTGGGGG - Intergenic
992190395 5:74285875-74285897 ACAGTCACAATGAGCACTCGTGG + Intergenic
994244715 5:97466793-97466815 AGAGTCCCAGTGACCTTTGCAGG + Intergenic
996787605 5:127257047-127257069 AAAGTTCCTGTGAGCTCTGGAGG + Intergenic
997437519 5:133885794-133885816 TCAGACCCAGTGATCTCTTGAGG + Intergenic
997698929 5:135882760-135882782 ACTATTCCAGGGAGCTCTGGGGG - Intronic
999247407 5:150162455-150162477 CCAGTCCCAGAGAGCACAGGGGG + Intergenic
999949998 5:156638369-156638391 CCTGTCCCACTGAGGTCTGGAGG + Intronic
1000883713 5:166726620-166726642 ACAGGCCCAGTGAACTTTTGTGG + Intergenic
1001053486 5:168430982-168431004 TGAGTACCAGTGAGCTATGGAGG - Intronic
1002847013 6:955787-955809 ACAGGGCCAGGGGGCTCTGGGGG + Intergenic
1003980010 6:11380569-11380591 TCAGTCACAGTGAGGCCTGGAGG + Intronic
1005834311 6:29696248-29696270 ACAATCCAAGTGGGCACTGGGGG + Intergenic
1005959339 6:30684787-30684809 CCAGTCCCAGCGTCCTCTGGTGG + Exonic
1006273728 6:32984426-32984448 ACATTGTCAGTGAGCACTGGAGG + Intergenic
1006411832 6:33878284-33878306 ACCCTCCCAGAGAGCTGTGGTGG - Intergenic
1006637935 6:35473907-35473929 ACAGGCCCAGCTGGCTCTGGGGG + Exonic
1007433116 6:41787710-41787732 ACTGTCCCGGTGAGCGCTGCTGG + Exonic
1007627441 6:43254515-43254537 ACAGCAGCTGTGAGCTCTGGGGG - Intronic
1007710096 6:43817429-43817451 AGAGGCCCAGGGAGCCCTGGAGG + Intergenic
1007946750 6:45833960-45833982 CCAGGCCCAGTGAGGTATGGAGG - Intergenic
1011499510 6:87972501-87972523 ACAGTCCCAGTTAGCTCACTAGG + Intergenic
1015493488 6:133855019-133855041 ACAGTCCCTCTGACCTCAGGCGG + Intergenic
1015923322 6:138286950-138286972 TCATTCCCAGTGAGTTCTGCAGG - Intronic
1019102138 6:169640138-169640160 CCATTCCCTGTGAGCTATGGAGG - Intronic
1021071672 7:16249128-16249150 TCAGCCTCACTGAGCTCTGGTGG - Intronic
1021666714 7:22989410-22989432 AAAGTTGCAGTGAGCTATGGTGG - Intronic
1024518676 7:50283887-50283909 AAAGTCCCAGTGAGCTCAGCAGG + Intergenic
1025189177 7:56883688-56883710 GCAGAACCAGAGAGCTCTGGTGG + Intergenic
1025682762 7:63693229-63693251 GCAGAACCAGAGAGCTCTGGTGG - Intergenic
1026590029 7:71686443-71686465 AAGGTCACAGTGAGCTCTGGTGG - Intronic
1029177084 7:98672440-98672462 GCAGTCCCAGCAAACTCTGGAGG - Intergenic
1032315065 7:130829680-130829702 ACCATCCCAGTGAGCACTGGTGG - Intergenic
1033411198 7:141119319-141119341 TTGGTCCCAGTGAGCTCTAGTGG + Intronic
1034066910 7:148145816-148145838 CCAGTCCCAATGACCCCTGGAGG + Intronic
1035241044 7:157529372-157529394 ACAGCCCAAGTGGGCTCTGTGGG - Intergenic
1036585572 8:10120184-10120206 ACAGTCTCTGTGTGCTCTGCTGG - Intronic
1038687152 8:29729042-29729064 AGAGTCCCAGGGAGCACAGGGGG - Intergenic
1039041657 8:33414315-33414337 AGAGTTCCTCTGAGCTCTGGGGG - Intronic
1039807211 8:41010664-41010686 TCAGTCACAGTGATCTGTGGAGG - Intergenic
1044077988 8:87846856-87846878 GCAGCCCCACAGAGCTCTGGGGG - Intergenic
1044176079 8:89124437-89124459 ACAGTCCAAATGACCTATGGTGG + Intergenic
1045220710 8:100197201-100197223 ATAGTCCCAGGGAGCTCAGGAGG + Intronic
1048467075 8:134674504-134674526 TCCGTCCCAGGGAGCTGTGGTGG - Intronic
1048927147 8:139281302-139281324 ACAGTCCCAGTGACCCTTTGAGG - Intergenic
1050221715 9:3398678-3398700 ACATTCCCATCCAGCTCTGGGGG - Intronic
1054912559 9:70467317-70467339 CCAGTCACAGGCAGCTCTGGAGG - Intergenic
1055327094 9:75142157-75142179 GCACTCCCAGTGAGCTCTCATGG - Intronic
1057888091 9:98846269-98846291 TCAGTCCCAGTGAGCCTGGGGGG + Intronic
1058870531 9:109198030-109198052 ACAGTCCTAATGATCTCTGGGGG - Intronic
1058934883 9:109760820-109760842 AAACTCCCAGGGAGCTCTTGGGG - Intronic
1059461266 9:114431925-114431947 CCTGTCCCAGTGAGCTCTGGTGG - Intronic
1060216453 9:121741360-121741382 ACAAACCCAGAGAGGTCTGGAGG + Intronic
1060762998 9:126271796-126271818 TGAGTGCCAGTGAGCACTGGTGG + Intergenic
1061424741 9:130491904-130491926 ACAGGCCCTCTGAGCTGTGGGGG - Intronic
1062552901 9:137098245-137098267 CCAGTCCCAGGCAGCTCTGGGGG + Intronic
1187090222 X:16088499-16088521 AAAGTTCCACTGAGCTTTGGGGG + Intergenic
1188070402 X:25711433-25711455 AGAGTCCTAATGAGCTCTGTAGG + Intergenic
1188645876 X:32566653-32566675 AAAGTTCCTGTGAGCTGTGGAGG + Intronic
1190559273 X:51671163-51671185 CCTGTCCCAGTGAGGCCTGGAGG + Intergenic
1190565018 X:51722158-51722180 CCTGTCCCAGTGAGGCCTGGAGG - Intergenic
1190775344 X:53548059-53548081 TCAGTGCCAGTGAGCGCTGGCGG - Exonic
1191058607 X:56270614-56270636 TCATTCCCAGTGAGCCCTGTGGG + Intronic
1194614735 X:96086973-96086995 GCAGCCCCAGTGAGCATTGGAGG - Intergenic
1198025456 X:132701620-132701642 CCTGTCCCATTGAGCTCTGTGGG - Intronic
1199710386 X:150465015-150465037 ACAAGCCCAGTGCCCTCTGGAGG + Intronic
1200217610 X:154374893-154374915 GCAGTCCCTGTGGGCGCTGGAGG - Intergenic
1201371565 Y:13269888-13269910 CCAGTCCCAGTGAGATGAGGAGG + Intronic
1202057285 Y:20848275-20848297 TCTGTCCCAGGGAGCTGTGGTGG + Intergenic