ID: 1185080819

View in Genome Browser
Species Human (GRCh38)
Location 22:48708471-48708493
Sequence TGGACATGGGCCTTTTCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185080812_1185080819 6 Left 1185080812 22:48708442-48708464 CCAAGGGCGGGAGCTTGGGGAAC No data
Right 1185080819 22:48708471-48708493 TGGACATGGGCCTTTTCTGAAGG No data
1185080803_1185080819 30 Left 1185080803 22:48708418-48708440 CCTGGGTCTCTAGAGCTGCTCTT No data
Right 1185080819 22:48708471-48708493 TGGACATGGGCCTTTTCTGAAGG No data
1185080811_1185080819 7 Left 1185080811 22:48708441-48708463 CCCAAGGGCGGGAGCTTGGGGAA No data
Right 1185080819 22:48708471-48708493 TGGACATGGGCCTTTTCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185080819 Original CRISPR TGGACATGGGCCTTTTCTGA AGG Intronic