ID: 1185081037

View in Genome Browser
Species Human (GRCh38)
Location 22:48709487-48709509
Sequence AACGAAAGGCTGCGCCTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 31
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 29}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185081037_1185081042 25 Left 1185081037 22:48709487-48709509 CCAGTCAGGCGCAGCCTTTCGTT 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1185081042 22:48709535-48709557 CGGCCACCTCGCCCTGAATTTGG 0: 1
1: 0
2: 0
3: 2
4: 47
1185081037_1185081045 29 Left 1185081037 22:48709487-48709509 CCAGTCAGGCGCAGCCTTTCGTT 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1185081045 22:48709539-48709561 CACCTCGCCCTGAATTTGGGAGG 0: 1
1: 0
2: 0
3: 6
4: 90
1185081037_1185081041 5 Left 1185081037 22:48709487-48709509 CCAGTCAGGCGCAGCCTTTCGTT 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1185081041 22:48709515-48709537 CATAGAAGCTTCAACATAAGCGG 0: 1
1: 0
2: 1
3: 7
4: 136
1185081037_1185081046 30 Left 1185081037 22:48709487-48709509 CCAGTCAGGCGCAGCCTTTCGTT 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1185081046 22:48709540-48709562 ACCTCGCCCTGAATTTGGGAGGG 0: 1
1: 0
2: 0
3: 5
4: 90
1185081037_1185081043 26 Left 1185081037 22:48709487-48709509 CCAGTCAGGCGCAGCCTTTCGTT 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1185081043 22:48709536-48709558 GGCCACCTCGCCCTGAATTTGGG 0: 1
1: 0
2: 0
3: 3
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185081037 Original CRISPR AACGAAAGGCTGCGCCTGAC TGG (reversed) Intronic
900703083 1:4060137-4060159 AATAAAAGGCAGCGCCTGCCGGG + Intergenic
905576617 1:39049860-39049882 AACGAAAGGCTGAGGCAGGCAGG - Intergenic
913257531 1:116967255-116967277 CGCCAAAGGCTGCCCCTGACAGG - Exonic
922146809 1:222954722-222954744 AACAAAAGGCTGGGCCAGGCTGG + Intronic
1070722962 10:78769428-78769450 AAGGAAAGGCTTAGCCTGCCAGG - Intergenic
1073355976 10:102854462-102854484 AACGAAAGACTGCGACTCCCCGG - Intronic
1083526820 11:63375075-63375097 AATGAATGGATGAGCCTGACAGG - Intronic
1097245978 12:57607765-57607787 ATGGAAAGGCTGGGCCTCACGGG - Intronic
1098651032 12:72969311-72969333 AAGGAAAGGCAGTTCCTGACTGG - Intergenic
1137701989 16:50503907-50503929 AGGGAAAGGCTGCCCCTGATGGG - Intergenic
1137911602 16:52383605-52383627 AAGGAAAGGCTGCACCTACCTGG + Intergenic
1142296006 16:89222904-89222926 AGCGACAGGGTGCGCGTGACTGG + Intronic
1142296014 16:89222960-89222982 AGCGACAGGGTGCGCGTGACTGG + Intronic
1142738920 17:1919040-1919062 AACGAAAGTCTGCTCCTGCTGGG - Intergenic
1152597109 17:81243227-81243249 GACGACAGGCTGCTCCTGTCTGG - Intergenic
1152825998 17:82465244-82465266 AACTGAAGGCTGGGCCTGGCAGG - Intronic
931652692 2:64482791-64482813 AACCAAAGGCTAAGCCTGCCAGG - Intergenic
1173864363 20:46304917-46304939 AAAGACAGGCTGTGCCTGCCTGG - Intronic
1174286968 20:49480708-49480730 AATGAAAGGCTGGGCTGGACAGG + Intronic
1185081037 22:48709487-48709509 AACGAAAGGCTGCGCCTGACTGG - Intronic
958607945 3:96384225-96384247 AAGTAAAGGCTTGGCCTGACTGG + Intergenic
961073132 3:123955359-123955381 AAGGAAAGGCTGCTGCTGATTGG - Intronic
997135039 5:131316340-131316362 AAGGAAAGGATGTGCCTAACTGG - Intronic
997995559 5:138583125-138583147 AACTAAAGGCTGGGCCTGTAAGG - Intergenic
999596393 5:153209970-153209992 AAAGAAAGACTGTGCCTGGCTGG - Intergenic
1019475534 7:1242403-1242425 CCCCACAGGCTGCGCCTGACGGG + Intergenic
1033766000 7:144491264-144491286 AAGCAAAGGCAGCACCTGACAGG - Intronic
1037267523 8:17082158-17082180 TAAGAAATGCTGCACCTGACAGG - Intronic
1046362828 8:113184709-113184731 AACGAAAGCCTGCACCTGAGTGG - Intronic
1053303044 9:36965138-36965160 AAGGAAAGGCTGAGCCAGCCTGG - Intronic
1189446565 X:41085954-41085976 ATCGAAAGGCTGCGGCGGCCGGG - Exonic