ID: 1185085772

View in Genome Browser
Species Human (GRCh38)
Location 22:48740254-48740276
Sequence GGCTGGGAGGACGGCAGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185085751_1185085772 22 Left 1185085751 22:48740209-48740231 CCCAAGGAGAAGCCTATACCCCA No data
Right 1185085772 22:48740254-48740276 GGCTGGGAGGACGGCAGGGCAGG No data
1185085761_1185085772 -2 Left 1185085761 22:48740233-48740255 CCTGCTGGGTGTGGCCTCCCTGG No data
Right 1185085772 22:48740254-48740276 GGCTGGGAGGACGGCAGGGCAGG No data
1185085752_1185085772 21 Left 1185085752 22:48740210-48740232 CCAAGGAGAAGCCTATACCCCAC No data
Right 1185085772 22:48740254-48740276 GGCTGGGAGGACGGCAGGGCAGG No data
1185085759_1185085772 2 Left 1185085759 22:48740229-48740251 CCACCCTGCTGGGTGTGGCCTCC No data
Right 1185085772 22:48740254-48740276 GGCTGGGAGGACGGCAGGGCAGG No data
1185085750_1185085772 23 Left 1185085750 22:48740208-48740230 CCCCAAGGAGAAGCCTATACCCC No data
Right 1185085772 22:48740254-48740276 GGCTGGGAGGACGGCAGGGCAGG No data
1185085758_1185085772 3 Left 1185085758 22:48740228-48740250 CCCACCCTGCTGGGTGTGGCCTC No data
Right 1185085772 22:48740254-48740276 GGCTGGGAGGACGGCAGGGCAGG No data
1185085757_1185085772 4 Left 1185085757 22:48740227-48740249 CCCCACCCTGCTGGGTGTGGCCT No data
Right 1185085772 22:48740254-48740276 GGCTGGGAGGACGGCAGGGCAGG No data
1185085755_1185085772 10 Left 1185085755 22:48740221-48740243 CCTATACCCCACCCTGCTGGGTG No data
Right 1185085772 22:48740254-48740276 GGCTGGGAGGACGGCAGGGCAGG No data
1185085760_1185085772 -1 Left 1185085760 22:48740232-48740254 CCCTGCTGGGTGTGGCCTCCCTG No data
Right 1185085772 22:48740254-48740276 GGCTGGGAGGACGGCAGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185085772 Original CRISPR GGCTGGGAGGACGGCAGGGC AGG Intronic