ID: 1185086303

View in Genome Browser
Species Human (GRCh38)
Location 22:48742771-48742793
Sequence GTGTATTAGAAGAGGAGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185086296_1185086303 22 Left 1185086296 22:48742726-48742748 CCGGCAGCACAGTGGAGCAGGCA No data
Right 1185086303 22:48742771-48742793 GTGTATTAGAAGAGGAGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185086303 Original CRISPR GTGTATTAGAAGAGGAGAGA TGG Intronic
No off target data available for this crispr