ID: 1185086303

View in Genome Browser
Species Human (GRCh38)
Location 22:48742771-48742793
Sequence GTGTATTAGAAGAGGAGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 445
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 410}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185086296_1185086303 22 Left 1185086296 22:48742726-48742748 CCGGCAGCACAGTGGAGCAGGCA 0: 1
1: 0
2: 4
3: 33
4: 333
Right 1185086303 22:48742771-48742793 GTGTATTAGAAGAGGAGAGATGG 0: 1
1: 0
2: 0
3: 34
4: 410

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185086303 Original CRISPR GTGTATTAGAAGAGGAGAGA TGG Intronic
900086923 1:903122-903144 ATGTATAAGAAGAGGAGATGAGG - Intergenic
900880250 1:5376534-5376556 GTGGATCAGAAAAGCAGAGATGG + Intergenic
901473564 1:9473909-9473931 GCTTATAAGAAGAGGAGACATGG - Intergenic
901661566 1:10801145-10801167 TTGCATTAGGAGAGGAGAAAGGG + Intergenic
902162195 1:14540021-14540043 CTGTATTACTAGGGGAGAGAGGG + Intergenic
902252291 1:15162030-15162052 GTGAGAGAGAAGAGGAGAGAAGG + Intronic
902597101 1:17516843-17516865 GTGTAAGAGAAGAGGAGGGAAGG - Intergenic
902933900 1:19750657-19750679 GAGTGTTAGAGGGGGAGAGAGGG - Intronic
903298200 1:22359299-22359321 GTGTATTACATGACAAGAGATGG - Intergenic
904881188 1:33698420-33698442 GTCCATTAGAAAGGGAGAGATGG - Intronic
905165396 1:36079117-36079139 GTGTATTCCAATAGGAGAGACGG + Intergenic
905533619 1:38701606-38701628 GTGTTTGAGAGGATGAGAGATGG + Intergenic
906026426 1:42678021-42678043 GTGTATCAGATGACAAGAGATGG + Intergenic
906858955 1:49338477-49338499 TTGTATTTTAAGAGTAGAGATGG + Intronic
907698094 1:56754446-56754468 AAGTGTTAGAAGAGTAGAGAAGG - Intronic
907809442 1:57853817-57853839 CTGTGTTACAAGAGGTGAGAAGG + Intronic
908703349 1:66925116-66925138 CTGGAATAGAAGGGGAGAGATGG - Intronic
909540962 1:76791002-76791024 GTGGATTTGAAGAGGCAAGAGGG + Intergenic
910425444 1:87116133-87116155 GTATCTTAGAAGAAGAGATAAGG + Intronic
910538778 1:88330985-88331007 CTGTATAAGAAGAGGAGATTAGG + Intergenic
910790660 1:91046533-91046555 TGGTAATAGAAAAGGAGAGAAGG + Intergenic
910837537 1:91530889-91530911 GTGAAGCAGAAGAGGAGAAATGG + Intergenic
911266260 1:95747734-95747756 GTTGAATAGAAGAGGTGAGAGGG + Intergenic
911675811 1:100656813-100656835 GTGGGTGAGAAGAGAAGAGAAGG + Intergenic
911820658 1:102415680-102415702 TTGTCTTACAAGAGGAAAGAAGG + Intergenic
912128307 1:106568950-106568972 GTGTTTTAGAAAGAGAGAGAGGG + Intergenic
913965068 1:143370059-143370081 CTTTATAACAAGAGGAGAGAAGG + Intergenic
914059444 1:144195661-144195683 CTTTATAACAAGAGGAGAGAAGG + Intergenic
914119706 1:144770710-144770732 CTTTATAACAAGAGGAGAGAAGG - Intergenic
915216769 1:154345667-154345689 GCTTATTAAAGGAGGAGAGAAGG + Intronic
915431410 1:155869693-155869715 TTGTATTAGAAGAGGGACGAGGG + Intronic
916382038 1:164222494-164222516 GTATAGTAAAAGAGAAGAGAGGG - Intergenic
916463089 1:165046830-165046852 GTGTCTGAGAAGCTGAGAGATGG - Intergenic
916896612 1:169170131-169170153 GTATGTTAGAAGAAGAGAGCTGG + Intronic
916907366 1:169301907-169301929 GTGGACTACTAGAGGAGAGAAGG + Intronic
918146261 1:181758624-181758646 GTGTGGTACAGGAGGAGAGATGG - Intronic
918456594 1:184725862-184725884 GTGTTTTAGAAGATTAGTGAAGG + Intronic
918594819 1:186280617-186280639 GTAAATTAGAATAAGAGAGAAGG - Intergenic
919133034 1:193474619-193474641 GTGTCCTAGAAGCAGAGAGAGGG - Intergenic
920651630 1:207841829-207841851 GTGTAGCAGGAGAGCAGAGAAGG + Intergenic
921712185 1:218384084-218384106 ATGTTCTAGAAGAGGAGAGGGGG - Intronic
921837857 1:219796060-219796082 ATGTAAAAAAAGAGGAGAGATGG - Intronic
922679883 1:227585127-227585149 GAGTAGTAGAAGATGAGAAAAGG + Intronic
923374767 1:233350055-233350077 GCTAATTAGAAGAGGGGAGAGGG - Intronic
1063628681 10:7714510-7714532 ATGTAAGAGAAGAGGAGAGGAGG - Intronic
1064035291 10:11909199-11909221 GTGCAAGAGAAGAGGACAGAGGG - Intergenic
1064135424 10:12746594-12746616 GAGAAGTAGAACAGGAGAGACGG - Intronic
1064905836 10:20344397-20344419 AAGGATGAGAAGAGGAGAGACGG + Intergenic
1064988416 10:21234397-21234419 GTGAATTACATGAAGAGAGAGGG - Intergenic
1065234241 10:23631836-23631858 GTGTTTCAGGAGAGGAGAAAGGG + Intergenic
1065445557 10:25794923-25794945 ATGATTTAGAAGAGGAGAGAAGG - Intergenic
1066222920 10:33353844-33353866 GTCTATCAAAATAGGAGAGAAGG - Intergenic
1067524491 10:47029899-47029921 CTGTGTAAGAAGAGGAGACAAGG - Intergenic
1067533210 10:47089383-47089405 GTGTTTGAGAAGAAGAGAAATGG - Intergenic
1067741545 10:48899317-48899339 GTTCACTAGCAGAGGAGAGAAGG + Intronic
1067806988 10:49399215-49399237 GGGTATGAGATGCGGAGAGAAGG - Intergenic
1068076404 10:52261146-52261168 GTATTTTTGAAGAGGAGATAAGG - Intronic
1068793434 10:61051966-61051988 GGGCTTTAGAAGAGTAGAGAGGG + Intergenic
1069818852 10:71215318-71215340 GTGGATAAGAATAGGAGGGAGGG - Intronic
1069911843 10:71764889-71764911 GTGGGTTAGCAGAGGAGAGTTGG - Intronic
1071868354 10:89763448-89763470 CTGTATTGGAAGAGAAAAGAGGG + Intronic
1072339262 10:94430763-94430785 GGGGATTAGAAGAGAAAAGAGGG - Intronic
1072419659 10:95279426-95279448 CTGTATTAGAAGAGTCAAGAAGG - Intronic
1072905797 10:99452159-99452181 GTGTGTTTGAAGAGAAGAGGAGG - Intergenic
1072944402 10:99796883-99796905 ATGTGTTAGAAGACAAGAGAAGG - Intronic
1073069042 10:100781849-100781871 ATGGAGAAGAAGAGGAGAGAGGG - Intronic
1073107982 10:101043449-101043471 GTATAATAAAAGAAGAGAGAAGG - Intergenic
1073566050 10:104536590-104536612 GTGAAGGAGGAGAGGAGAGAGGG + Intergenic
1073589864 10:104746647-104746669 GTGGATGAGGAAAGGAGAGATGG - Intronic
1075523031 10:123155303-123155325 GTGTAACAGAAAAGGGGAGACGG - Intronic
1077345811 11:2052026-2052048 GAGTATAATGAGAGGAGAGAGGG - Intergenic
1078160673 11:8837236-8837258 GTGTATTTGGGGAGGAGGGATGG + Intronic
1079181047 11:18193799-18193821 ATGAAGAAGAAGAGGAGAGAGGG + Intronic
1079378410 11:19914989-19915011 CTGTATAAAAAGAGGAGAGAAGG - Intronic
1080207014 11:29741534-29741556 GGCATTTAGAAGAGGAGAGATGG + Intergenic
1080310355 11:30883214-30883236 CTGAATGACAAGAGGAGAGAAGG + Intronic
1080895209 11:36443208-36443230 GTGTATCACATGATGAGAGAAGG + Intronic
1081556188 11:44163946-44163968 TAGTCTCAGAAGAGGAGAGAGGG - Intronic
1082206101 11:49435887-49435909 GAGGATTAGAAGAGTAGAAAAGG - Intergenic
1085107701 11:73860145-73860167 AGGTATTATAAAAGGAGAGATGG - Intronic
1085577370 11:77618776-77618798 CTGTATCAGAAGAAAAGAGAAGG + Intronic
1085908674 11:80795654-80795676 GTGTCTGAGAACAGGAGACATGG - Intergenic
1086649165 11:89265884-89265906 GAGGATTAGAAGAGTAGAAAAGG + Intronic
1087179752 11:95129942-95129964 GTGTCTGAGAAAAGGAGAAAGGG + Exonic
1089178510 11:116565023-116565045 GAGTATTGGTAAAGGAGAGAGGG - Intergenic
1091516506 12:1188352-1188374 ATCTAATAGAAAAGGAGAGAGGG - Intronic
1091544183 12:1489773-1489795 GTGCATGAGAGCAGGAGAGAGGG - Intronic
1091573104 12:1708246-1708268 GTGGATTAGGAGGGTAGAGAGGG + Intronic
1092595836 12:10003946-10003968 GTGGATTAGATGAGGTTAGATGG - Intronic
1092816434 12:12316240-12316262 GTGTGTGAGGACAGGAGAGAAGG - Intergenic
1092959372 12:13581447-13581469 TTATGGTAGAAGAGGAGAGAGGG - Intronic
1093159003 12:15722785-15722807 GTGCCTTAAAAGAGGTGAGAAGG - Intronic
1093166481 12:15809631-15809653 GGCTATAAGAAGGGGAGAGACGG + Intronic
1094357532 12:29594209-29594231 GTGCTGTAGAAGAGTAGAGAAGG - Intronic
1096765373 12:53883913-53883935 GTGATTTACAAGAGGAGAAAAGG + Intergenic
1096933661 12:55243493-55243515 GTTTGTTAGGAGAGGTGAGATGG - Intergenic
1097060692 12:56281277-56281299 GGGTACTAGAAGAGGATGGAAGG + Intronic
1097227762 12:57488567-57488589 GTGTGTTAGGAGGGGAGAGAGGG - Intronic
1098058288 12:66532754-66532776 GTGAAGTGGAGGAGGAGAGAGGG - Intronic
1098062368 12:66576723-66576745 ATGTTTGAGAAGAGGAGAGGAGG - Intronic
1098292830 12:68974136-68974158 GTGTCTTGGAAGAAGAGACATGG - Intergenic
1098482978 12:70987134-70987156 GTGCCTTAGGAGAGGATAGAGGG - Intergenic
1100222092 12:92516322-92516344 GGGCATTTGAAGAGGAGAGAAGG + Intergenic
1101273222 12:103170524-103170546 GTGTACGAGGAGAGGAGAAATGG - Intergenic
1101838256 12:108310193-108310215 GTGTGTTAGGGGAGGGGAGAAGG + Intronic
1104688698 12:130807866-130807888 CTGTTTGAGAAGAGGAGGGAGGG - Intronic
1105507256 13:21020912-21020934 GTGAATTTGGAGAGAAGAGAAGG - Intronic
1106233340 13:27839949-27839971 GTGTATGGGAAGAGTATAGAGGG - Intergenic
1106461090 13:29969791-29969813 GTGTAGGAGAAGAGGATATAAGG - Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1107260871 13:38489543-38489565 CTGGCTTTGAAGAGGAGAGAAGG + Intergenic
1107320364 13:39179898-39179920 TGCTATTACAAGAGGAGAGAAGG - Intergenic
1107346826 13:39470903-39470925 GTATATCTGAAGTGGAGAGAGGG - Intronic
1107631482 13:42347636-42347658 GACTATTAGATGAGGGGAGAGGG - Intergenic
1108181182 13:47841469-47841491 GTGTCATAGAAGAAGAAAGAAGG - Intergenic
1109498564 13:63208793-63208815 GCTTCTTAGAAGAGAAGAGATGG + Intergenic
1111714785 13:91866531-91866553 AAGTATTACATGAGGAGAGAAGG - Intronic
1111787970 13:92815414-92815436 TTGTATTAGAGGAAGAGCGAGGG + Intronic
1111869546 13:93813022-93813044 GTCCTGTAGAAGAGGAGAGATGG - Intronic
1113202545 13:107883071-107883093 CTGTATTTGTAGAGGGGAGAGGG - Intergenic
1113409142 13:110068824-110068846 GTATTTTAGAAGAGCAAAGATGG - Intergenic
1113432030 13:110259502-110259524 GTGCAACAGAAGAGGAAAGATGG - Intronic
1113683516 13:112261632-112261654 GTGTATTCTAAGAGAAGAGGAGG - Intergenic
1114270084 14:21095374-21095396 GTGAATTAGAATAGGACTGAAGG + Intronic
1115522314 14:34245478-34245500 GGGACTTAGAAGAAGAGAGAAGG + Intronic
1115754788 14:36519888-36519910 GAGTAACAGAGGAGGAGAGATGG + Intronic
1116372252 14:44150922-44150944 ATGTATTTGAAGATGACAGAAGG - Intergenic
1117074758 14:52090885-52090907 GTGTCTAAGATGAGGACAGAGGG + Intergenic
1117270272 14:54136419-54136441 GTGTTTATGAAGAGGAGAGAAGG + Intergenic
1117309649 14:54509202-54509224 GAGTACAAGAAGAGGAGAAAAGG + Intergenic
1117514081 14:56482947-56482969 GTTTTTTAAAAGGGGAGAGAGGG - Intergenic
1119616344 14:76101358-76101380 CTGTCTTGGAAGTGGAGAGATGG + Intergenic
1121169759 14:91843837-91843859 ATGAATTAGAAGTGGAGGGAGGG + Intronic
1121445758 14:93977822-93977844 GTGTAGGAGAAGGGCAGAGAAGG + Intergenic
1125204505 15:37138079-37138101 TTGAATTAGAAAATGAGAGAAGG + Intergenic
1125402865 15:39322538-39322560 GTGTTTTAGAAGATATGAGAAGG + Intergenic
1126689198 15:51274838-51274860 GGGTATTTGAAGAAGAAAGAAGG + Intronic
1126788543 15:52199232-52199254 GTGAATTAGAAGGGCTGAGATGG - Intronic
1127182319 15:56434833-56434855 GAATATTAGAAGACTAGAGATGG - Intronic
1127395665 15:58542171-58542193 GTGGATGAGGAGAGGGGAGAAGG - Intronic
1129529116 15:76248273-76248295 GTGCATTAGTGGAGGAGAGAGGG + Intronic
1129818511 15:78578007-78578029 GAGGATTAGAAGAGGAGAAATGG + Intronic
1130174320 15:81552218-81552240 GGTTATTAGAGGATGAGAGAGGG + Intergenic
1130916089 15:88305912-88305934 GTGTATTAAGAGAGAAGAAAGGG + Intergenic
1131818363 15:96246167-96246189 GTGGATGGGAAGAGGTGAGATGG + Intergenic
1132394956 15:101465529-101465551 GGCTATTAGAAGAGGACAGAGGG + Intronic
1133708411 16:8377891-8377913 GTGAATTTGAAGAGTAGAGGAGG - Intergenic
1133876917 16:9743704-9743726 ATGTAGAAGAAGATGAGAGATGG + Intergenic
1134316046 16:13119923-13119945 GTTTTTTAGAAGAGGAGTGGTGG + Intronic
1135309288 16:21392714-21392736 GTTTCTTTGCAGAGGAGAGAGGG + Intergenic
1135347923 16:21705146-21705168 CTGTGTGAGAAGAGGAGGGATGG - Intronic
1136034139 16:27526010-27526032 GTGTTTTGGAAGTGGAGAGGAGG + Intronic
1136148865 16:28333033-28333055 GTTTCTTTGCAGAGGAGAGAGGG + Intergenic
1136306031 16:29371844-29371866 GTTTCTTTGCAGAGGAGAGAGGG + Intergenic
1138257716 16:55581877-55581899 GTGTTTTAGAAGCTGAGATAGGG - Intronic
1139082296 16:63537888-63537910 GTAAAATAGAGGAGGAGAGATGG - Intergenic
1139094713 16:63691610-63691632 GTGGATTAAAAGAAGAAAGATGG + Intergenic
1139142010 16:64276852-64276874 TTGTAATAGAATAGGAGAGATGG - Intergenic
1139142291 16:64281120-64281142 TTGTAATAGAATAGGAGAGATGG - Intergenic
1140058469 16:71546410-71546432 ATGTGATAGAAGAGGAAAGACGG - Intronic
1140438112 16:74965232-74965254 GGTTATTAGAAAAGCAGAGATGG + Intronic
1140452804 16:75084720-75084742 ATGTATTAGAAGAACAGTGAGGG - Intronic
1143773165 17:9181149-9181171 CTTTGTTAGAGGAGGAGAGAAGG - Intronic
1146115151 17:30130038-30130060 TTCTATTAGAAGTGGGGAGATGG + Intronic
1149037411 17:52150309-52150331 GTGTTTGAGGAGAAGAGAGAAGG - Intronic
1149079382 17:52635426-52635448 GTGGATTACTAGAGGGGAGAGGG + Intergenic
1149262330 17:54893540-54893562 TGGTATTAGAAGAGAAAAGAAGG + Intergenic
1149382227 17:56105737-56105759 GTGTATGAGACAGGGAGAGAGGG + Intergenic
1149524925 17:57348063-57348085 TCGCATTAGAAGGGGAGAGAAGG + Intronic
1149986616 17:61352529-61352551 GTGGAGTAGAAGTGGAGGGAAGG + Intronic
1150340049 17:64359161-64359183 GTGGATGTGAATAGGAGAGAGGG - Intronic
1151689282 17:75671390-75671412 GTGTATATGAAAAGGAAAGAAGG + Intronic
1152110288 17:78353870-78353892 GGGTATGGGATGAGGAGAGAAGG + Intergenic
1153242204 18:3041298-3041320 GTGGATTAGATGGGGAGAAAAGG + Intergenic
1153445533 18:5168409-5168431 GTATTGTAGAAGAGGAAAGATGG + Intronic
1153707920 18:7766318-7766340 GGGTATTAGAATACAAGAGATGG + Intronic
1153989546 18:10384366-10384388 GAATATTAGAAGAGGACAAATGG + Intergenic
1156124994 18:33893272-33893294 GTGGTTTAGAAGAGTACAGATGG + Intronic
1156670296 18:39461256-39461278 GTCTAATGGAAGAAGAGAGATGG - Intergenic
1157029591 18:43889667-43889689 GTCTATGAGAAGAAGGGAGAAGG + Intergenic
1157371362 18:47115283-47115305 AGGTATTACAAGAGGAAAGATGG - Exonic
1159470040 18:68840989-68841011 GTTTCTTAAAAGAGGAGAGTAGG - Intronic
1159823409 18:73175324-73175346 CTGTCTTAGAAGGGGAGAGTTGG - Intronic
1161191535 19:2959857-2959879 GAGTATCAGCAGAGGAGGGACGG + Intergenic
1162247818 19:9417196-9417218 TTGTATTATTAGTGGAGAGAGGG - Intronic
1162725210 19:12686160-12686182 GTGTAGCTGGAGAGGAGAGAGGG - Intergenic
1163710986 19:18846682-18846704 GTAGATTAGAAGAGGGGAGAAGG + Intronic
1164500342 19:28814455-28814477 CTTTATAAGAAGAGGAGAGAGGG - Intergenic
1166001754 19:39881654-39881676 GTGTATTTGAAGCTGAGAGGCGG - Intronic
1166004536 19:39897905-39897927 GTGTATTTGAAGCTGAGAGGCGG - Intronic
1166299764 19:41907075-41907097 ATGTAGGAGAAGAGGGGAGACGG - Intronic
1167992887 19:53375691-53375713 GAAAATGAGAAGAGGAGAGAGGG - Intronic
1168005855 19:53486553-53486575 GAAAATGAGAAGAGGAGAGAGGG - Intronic
1168417064 19:56175917-56175939 GGGGATTAGAAGAAGGGAGAGGG - Intergenic
1202698846 1_KI270712v1_random:147548-147570 CTTTATAACAAGAGGAGAGAAGG + Intergenic
925131711 2:1498345-1498367 TCCCATTAGAAGAGGAGAGAAGG + Intronic
927774106 2:25888717-25888739 GTTTATAAGGAGAGGAGAGTGGG - Intergenic
928773394 2:34729549-34729571 GTATATTAGATGATGAGAGTGGG - Intergenic
929101653 2:38320755-38320777 GTGAATTAGGAGTGGAGAGATGG + Intronic
929155019 2:38781269-38781291 GTGTATTAGAAAAGAAGGCAGGG - Intronic
929438701 2:41948746-41948768 GGGGATAAGAGGAGGAGAGAAGG - Intronic
929683067 2:44010837-44010859 ATGCATTATAAGAGGAAAGAAGG - Intergenic
929786684 2:44998676-44998698 GAGAATTAGAAAAGCAGAGAAGG - Intergenic
929977202 2:46646447-46646469 GGGTTTTGGAAGAGGAGGGATGG - Intergenic
930388375 2:50727790-50727812 ATGAATCAGAAGAGGAGACAGGG + Intronic
930532810 2:52611946-52611968 GTTTCATAGAAGAAGAGAGATGG + Intergenic
930997662 2:57740764-57740786 GTAGATTTGAAGAGGAGAAAAGG + Intergenic
931308726 2:61057944-61057966 GTCTCATAGAAGTGGAGAGAGGG - Intergenic
932407172 2:71521348-71521370 ATGTTTGAGAAGAGGAGAAAAGG + Intronic
932414357 2:71564768-71564790 GGGTGTTAGAAGAGGAGAAAGGG - Intronic
934169794 2:89531024-89531046 CTTTATAACAAGAGGAGAGAAGG + Intergenic
934280096 2:91605332-91605354 CTTTATAACAAGAGGAGAGAAGG + Intergenic
935851504 2:107225660-107225682 GAGTAGGAGAAAAGGAGAGAAGG - Intergenic
935996474 2:108779463-108779485 ATGTTTTTAAAGAGGAGAGAGGG - Intronic
936892626 2:117390199-117390221 GTGATTTTGAAGAGGAGAAATGG + Intergenic
937188271 2:120067116-120067138 ATTTATTAAAAGATGAGAGATGG + Intronic
937429454 2:121826093-121826115 CTGTGCTAGAAGTGGAGAGAGGG - Intergenic
939041049 2:137189778-137189800 GTGAAATAGCAGATGAGAGAAGG - Intronic
939045328 2:137243312-137243334 GTGTATGAGACTAGGAGAGAGGG - Intronic
939182438 2:138819090-138819112 GTGAATTAGAGGAGGTGAGGGGG - Intergenic
940336684 2:152536134-152536156 GTGGGCTAGAAGAGGGGAGAGGG - Intronic
941080963 2:161060050-161060072 CTGCCTTAGAAGAGGAGAAAGGG - Intergenic
941584764 2:167343828-167343850 CTGTATTAGAAGGGGAAAGATGG + Intergenic
941924968 2:170885534-170885556 GAGTCATAGAAGAGGAGAGTAGG - Intergenic
941958685 2:171231301-171231323 GTGTCCTAGAAGAGAAGAGAGGG - Intronic
942979765 2:182066472-182066494 GTGAATTAGAAGGGGATATATGG - Intronic
943313900 2:186361577-186361599 ATGTTATTGAAGAGGAGAGACGG + Intergenic
944108408 2:196104244-196104266 GTGAGTAAGAAGAGGGGAGAAGG + Intergenic
944140381 2:196449956-196449978 GCATATAAGAAGAGGAGACAAGG - Intronic
945650091 2:212546728-212546750 GTTTATTAGAATGGGAGAGTAGG + Intergenic
945827445 2:214741089-214741111 TTGTTTTAGCTGAGGAGAGATGG - Intronic
947309581 2:228786347-228786369 GTGTAGTAACAGAGGTGAGAAGG - Intergenic
947586481 2:231360043-231360065 CTGTAGGAGAAGAGGAGAGGCGG + Intronic
947987664 2:234462875-234462897 ATGCATGGGAAGAGGAGAGATGG + Intergenic
1169555001 20:6740127-6740149 GTGGAAGAGAAGAGGAGAAAAGG - Intergenic
1169866034 20:10201118-10201140 GTGTAGAAAAAGAAGAGAGAAGG - Intergenic
1170689103 20:18596029-18596051 GTGTATTTGAGGATGAGAGTGGG + Exonic
1172427152 20:34863203-34863225 GAGTGGTAGAAGGGGAGAGAGGG - Intronic
1173052482 20:39577022-39577044 GTGAATGTGAAGAGGAGCGAGGG + Intergenic
1173162605 20:40663785-40663807 GTGTGTTGGAAGAAGAGAGAAGG + Intergenic
1173893994 20:46536475-46536497 GAGTAATGGAAGAGGAGAAATGG + Intergenic
1174435568 20:50504322-50504344 GTTTATTAGAAGTGGTCAGAAGG + Intergenic
1174708550 20:52681907-52681929 GAGTATTAGATGATCAGAGAGGG - Intergenic
1175485125 20:59340316-59340338 GTGTGTTGCAAGAGAAGAGATGG + Intergenic
1176117609 20:63439888-63439910 CTGTAGGGGAAGAGGAGAGAGGG - Intronic
1176291699 21:5049047-5049069 GTATTTTAGTAGAGGAGACAGGG - Intergenic
1176950130 21:15034657-15034679 GTGTATGAGGAGAGGAGAGCTGG + Intronic
1177919127 21:27128618-27128640 ACCTATTAGCAGAGGAGAGAAGG - Intergenic
1178008884 21:28259170-28259192 GTCTTTAAGAAGAGTAGAGAGGG - Intergenic
1178689940 21:34742494-34742516 GGGTATTAGAAGATGACAGCAGG - Intergenic
1178897216 21:36568760-36568782 GTCTGTGAGAAGAGGAAAGAGGG - Intronic
1179497811 21:41784977-41784999 GGGAATTCTAAGAGGAGAGAAGG - Intergenic
1179865556 21:44214594-44214616 GTATTTTAGTAGAGGAGACAGGG + Intergenic
1181602214 22:23959392-23959414 GGGTATTAGAAGAGAAGACAAGG - Intronic
1181606295 22:23981915-23981937 GGGTATTAGAAGAGAAGACAAGG + Intronic
1182346630 22:29671057-29671079 GTGGATTAGAAATGGTGAGATGG + Intronic
1182836384 22:33345401-33345423 GGGTATTAGAAGGGGAAAGTAGG - Intronic
1183403329 22:37617420-37617442 GTTCAATAGCAGAGGAGAGAGGG + Intronic
1184318631 22:43720710-43720732 GTGGTGTAGAAGAGAAGAGAGGG + Intronic
1184518560 22:44978726-44978748 GTGTAGTAGAAGAGGAAAAAAGG - Intronic
1185086303 22:48742771-48742793 GTGTATTAGAAGAGGAGAGATGG + Intronic
949567353 3:5257325-5257347 ATGTATAAGAAGAGCAGAAATGG + Intergenic
950005235 3:9687172-9687194 GAATCTTAGAAGAGGGGAGAGGG + Intronic
950140521 3:10612048-10612070 GTGTGGTTGGAGAGGAGAGATGG - Intronic
951774334 3:26292423-26292445 GTATTTTGGAAAAGGAGAGATGG + Intergenic
952484453 3:33796283-33796305 GTATATGAAAAGAGGAGAAAGGG - Intergenic
952504906 3:33998856-33998878 TTGTAGAAGAAGAGGAGTGAGGG + Intergenic
952539873 3:34356795-34356817 GGATCTTAGAAGAGGAGAAAAGG - Intergenic
952802287 3:37306541-37306563 GTGTATCAGGATAGGAGATAGGG + Intronic
953412072 3:42696303-42696325 TGGTGTGAGAAGAGGAGAGACGG - Intronic
954681554 3:52348818-52348840 GTGAATGAGCAGAGGGGAGATGG - Intronic
954784249 3:53081419-53081441 GGGGATTGGAAGAGGAAAGAAGG + Intronic
954819383 3:53312358-53312380 GTGTGGTAGAAGAGGAGACACGG - Exonic
955323348 3:57990759-57990781 GTGGATTAGAGGAAGGGAGAGGG + Intergenic
955929024 3:64037176-64037198 GTTTCTTAGAAGATGGGAGAAGG - Intergenic
956735766 3:72236896-72236918 GTGTATTAAAAGCTGAGAGTTGG - Intergenic
957134736 3:76271749-76271771 GTTTGTGAGGAGAGGAGAGAAGG - Intronic
957158508 3:76577998-76578020 TTGTATTAGAGTAGTAGAGAAGG - Intronic
957275645 3:78087974-78087996 ATGTTTTAGGGGAGGAGAGAAGG + Intergenic
957530790 3:81438681-81438703 TTGTAGTAGAAGAGGATAAAAGG - Intergenic
957814391 3:85274395-85274417 ATGTCTTAGAAGAGATGAGAAGG + Intronic
960169344 3:114440248-114440270 GTGAAGTAGATGAGGATAGATGG + Intronic
960321741 3:116245146-116245168 CTTTATAAGAAGAGGAGACAAGG + Intronic
962508824 3:136077673-136077695 GTGTAGGAGAAGACCAGAGAAGG - Intronic
963031394 3:140981712-140981734 GTGCATTGGAAGAGCAGGGAGGG - Intergenic
963461620 3:145621204-145621226 GTGTCTTAAAGGAGGAGAGTTGG + Intergenic
963474181 3:145782246-145782268 GAGAATCAAAAGAGGAGAGAAGG + Intergenic
963852037 3:150218887-150218909 TTGTATTTGAAGAAGAGACAGGG + Intergenic
964863817 3:161231625-161231647 GTATATTTGAGGAGGAGACAAGG + Intronic
965574655 3:170205883-170205905 GTGGATTACATGAGGTGAGAAGG - Intergenic
965953161 3:174335221-174335243 ATGTGATAGAATAGGAGAGAAGG + Intergenic
966684205 3:182676330-182676352 GTAATTTAGAAGAGGGGAGATGG - Intergenic
966769816 3:183493718-183493740 GTGGAGAAGAATAGGAGAGAAGG + Intronic
967393256 3:188978179-188978201 GTGGATTAGAAGAGATGATAGGG + Intronic
968914387 4:3490899-3490921 ATGAATGAGCAGAGGAGAGAAGG - Intronic
968951594 4:3697697-3697719 CTGTATCAGAGGAGAAGAGAAGG + Intergenic
969030664 4:4210519-4210541 CTTTATAAGAAGAGGAGAGAAGG - Intronic
971115318 4:23639702-23639724 GAATATTTGGAGAGGAGAGATGG - Intergenic
971875890 4:32308029-32308051 GTGTGTTAAAAGAGGAAAAATGG + Intergenic
972127759 4:35790257-35790279 GGGAAGTAGAAGAGGAGAGCTGG + Intergenic
974074654 4:57157527-57157549 GTGCAAGAGAAGAGGACAGATGG - Intergenic
974099425 4:57400675-57400697 GTCTAGGAAAAGAGGAGAGAGGG - Intergenic
975020434 4:69480648-69480670 GTTTGTTAGAACAGGAAAGAAGG - Exonic
975322739 4:73026748-73026770 GTGTTGTACAAAAGGAGAGAAGG + Intergenic
975542658 4:75530898-75530920 GTGAATTAAATGAAGAGAGATGG + Intronic
978884698 4:113753493-113753515 GTAGGTTTGAAGAGGAGAGAGGG - Intronic
981624735 4:146742673-146742695 GAGGAGTAGAAGAGGAAAGAAGG - Intronic
982664714 4:158248080-158248102 AAGTATTAAAAGAAGAGAGAGGG + Intronic
983198905 4:164839355-164839377 GTGTTTTATGAAAGGAGAGAAGG + Intergenic
983218327 4:165021232-165021254 GTGGAGCAGAAGAAGAGAGAGGG - Intergenic
983280426 4:165674052-165674074 TTGTACTAGAAGAGCAGGGAGGG + Intergenic
984146767 4:176071057-176071079 GTTAATTAGAAGGGGAGCGAGGG + Intronic
985189730 4:187359389-187359411 GTGTATTAGAAAAACGGAGAAGG + Intergenic
985314488 4:188641593-188641615 GTATATTATAAAAGAAGAGATGG - Intergenic
986539309 5:8827366-8827388 GAGTATTAGAATGGGAGTGAGGG + Intergenic
986944312 5:12996782-12996804 GTGTATTTCTTGAGGAGAGAAGG - Intergenic
987170561 5:15253011-15253033 ATGTATTAGGAGAGGTGTGACGG + Intergenic
988031282 5:25766637-25766659 GTTTATTAGAATAGCAAAGAAGG + Intergenic
988467587 5:31505427-31505449 ATGCATGAGAAAAGGAGAGAAGG + Intronic
988973985 5:36497113-36497135 TTGTATTAGAAGAAAAGAGGAGG - Intergenic
989138239 5:38176488-38176510 GTGTCTTGGAAGAGGAGTTAGGG - Intergenic
989701908 5:44277854-44277876 GACTATAAGAAGAGGAGAAATGG + Intergenic
990059334 5:51628261-51628283 GTGTAGCAAAAGGGGAGAGATGG - Intergenic
991595652 5:68302732-68302754 GTCTAGTAGTAGAGGGGAGAGGG + Intergenic
993614301 5:90092052-90092074 GTCAATTTGAAAAGGAGAGAAGG - Intergenic
993668788 5:90734399-90734421 GTGTTGAAGAAGAGGAGAAAAGG - Intronic
994004914 5:94826665-94826687 GTGTATAAGAGAAGAAGAGAAGG - Intronic
994562168 5:101388961-101388983 GAGTAATAGAAGAGGACATAGGG - Intergenic
995850209 5:116536962-116536984 GGCTATTAGGAGAGGAAAGATGG + Intronic
996800474 5:127397210-127397232 GTGCATTAGAAGAGAAAAGGAGG + Intronic
997255247 5:132423452-132423474 GTGAAGTAGAAGAGGAAAGCAGG + Intronic
997877468 5:137562141-137562163 GTATATTAAATGAGGAAAGAGGG + Intronic
1000263392 5:159611672-159611694 GTGGGTTAGAGGAGGAGATAAGG + Intergenic
1001154715 5:169263038-169263060 CCTTATTAGAAGAGGAGACAGGG + Intronic
1001648353 5:173298421-173298443 GAGGATTAGAAAAGGAGAAAGGG + Intergenic
1003474261 6:6467047-6467069 GTTTATTAGTAGATGACAGATGG - Intergenic
1003751934 6:9068689-9068711 GTGTGTTACAAGAGGAGATAAGG - Intergenic
1003904643 6:10688122-10688144 GCGTAAGAGAAGAGGAGAGAAGG - Intronic
1004683512 6:17919587-17919609 GTGCATTAGGAGTGGAGACATGG - Intronic
1004743448 6:18486508-18486530 ATGTGTTAGAAGAGGGAAGATGG + Intergenic
1005155762 6:22804660-22804682 GTGTACAAGAAGAGGAGGGGAGG + Intergenic
1006139179 6:31917472-31917494 GACTACTAGAAGGGGAGAGAGGG + Intronic
1006596768 6:35199293-35199315 GTGTATTGTAGCAGGAGAGACGG + Intergenic
1008235870 6:49049062-49049084 GTGTAAGAGAAGAGAAGAGGAGG + Intergenic
1008760595 6:54847541-54847563 GTGATCTAGAAGAGGAGAGTAGG + Intronic
1008871366 6:56276204-56276226 GTGGATTACCAGAGGGGAGAAGG + Intronic
1011362003 6:86537244-86537266 GTGTAAAAGAGGGGGAGAGAGGG - Intergenic
1011430986 6:87286493-87286515 ATGTACTAGAAGGGGAGGGAAGG - Intronic
1011890565 6:92154112-92154134 GAGTGTTAGAAAAGGAGAGCAGG + Intergenic
1012663553 6:101936560-101936582 GTGTGTTAGATGAGGAAAGGGGG - Intronic
1016831407 6:148436892-148436914 GTATGTTAGGGGAGGAGAGAAGG + Intronic
1017819472 6:158038917-158038939 GTGAACTGGAAGAGCAGAGAGGG + Intronic
1017976170 6:159359280-159359302 GTGTATTTTTAGAGGAGACAGGG - Intergenic
1019196799 6:170287909-170287931 GTGTATTAGAGAGGGAGAGGAGG - Intronic
1019657220 7:2202299-2202321 GGGGTTGAGAAGAGGAGAGATGG + Intronic
1021350122 7:19582222-19582244 AAGTTTTAGAAGAGAAGAGAGGG + Intergenic
1021819624 7:24483599-24483621 ATGAATTAAAAGAGGAGAAAGGG + Intergenic
1022020197 7:26392303-26392325 TAGCATTAGAAGAGAAGAGAAGG + Intergenic
1022881745 7:34595074-34595096 GTGAATAAGAAGAGGAGGCAAGG - Intergenic
1024760527 7:52591332-52591354 GAGAATTAGAAGAAAAGAGAAGG + Intergenic
1024918826 7:54535375-54535397 GTGTGATAGAACTGGAGAGAAGG - Intergenic
1026740150 7:72974114-72974136 CTGAATCAGCAGAGGAGAGAAGG + Intergenic
1027103583 7:75390956-75390978 CTGAATCAGCAGAGGAGAGAAGG - Intergenic
1027244908 7:76359947-76359969 ATGTCTTAGGAGGGGAGAGAAGG - Intergenic
1027361093 7:77411023-77411045 GAGAATTAGAAGAGGAGACTAGG + Intronic
1027939932 7:84664844-84664866 GTATAGAAGAAGAGGAGAAAAGG + Intergenic
1028354458 7:89888631-89888653 TTCTATAAGAAGAGGAGGGATGG - Intergenic
1029982239 7:104889973-104889995 GCGAATGAGAAGAGGAGAGAAGG - Intronic
1030135953 7:106248201-106248223 AAGAATTAGAAGATGAGAGAAGG - Intergenic
1030826457 7:114165235-114165257 GTGGAATAGGAGAGGTGAGAAGG - Intronic
1031418771 7:121524363-121524385 GAGAATGAGAAGAGTAGAGAAGG - Intergenic
1031490612 7:122383320-122383342 GTGGACTAGTAGAGGGGAGAGGG + Intronic
1033271216 7:139934742-139934764 GCTTATTAGAAGAGGAGATTGGG - Intronic
1033389430 7:140912453-140912475 CTGTCTTAGAAGAGGTAAGAGGG - Intronic
1038253443 8:25927645-25927667 GAGTGTTAGAAGAGGGGACAGGG + Intronic
1040872768 8:52117697-52117719 GCATTTCAGAAGAGGAGAGAAGG + Intronic
1041328984 8:56702267-56702289 GTGTAACTGGAGAGGAGAGAAGG + Intergenic
1041470954 8:58208535-58208557 GTGTATTACAACAAGAGAGAAGG + Intergenic
1042563535 8:70091420-70091442 GTCTATTAGAAGAGGCTGGAAGG + Intergenic
1042998094 8:74723267-74723289 GTGTATTTGAAGAAGAATGATGG - Intronic
1043109670 8:76164648-76164670 GAGTACTAGATGAGGAGAGTGGG - Intergenic
1043167647 8:76924353-76924375 TTGTCTTAGAGGAGTAGAGAGGG + Intergenic
1043252810 8:78096993-78097015 GTGTATTAGAAATATAGAGAGGG + Intergenic
1043523402 8:81071291-81071313 GTGCAGTAGAAGGTGAGAGAAGG + Intronic
1044104246 8:88183047-88183069 GGCTTTTGGAAGAGGAGAGAAGG + Intronic
1045521537 8:102907165-102907187 GTCTATGAGAAGAGGATAAAAGG - Intronic
1045997864 8:108384461-108384483 GTGCATTAGGAGTGGAGAAAAGG + Intronic
1046473692 8:114712810-114712832 ATTTATTAGAAGAGGACAGAGGG - Intergenic
1047014580 8:120710179-120710201 GTGTTTTAGAATAGGAGGAAGGG - Intronic
1047647686 8:126886163-126886185 GTGTTTAAGAAGAGGGAAGAAGG - Intergenic
1047924788 8:129672071-129672093 GTGAATCAGAGGATGAGAGAAGG - Intergenic
1049498186 8:142946529-142946551 CTTTATTAGAAGAGGAGATGAGG - Intergenic
1049569645 8:143363137-143363159 GTGAGTCAGAAGAGCAGAGACGG - Intergenic
1050615880 9:7401308-7401330 CTGTATTTAAAGAGGAGAGAGGG - Intergenic
1050768686 9:9169112-9169134 GTGTATTAGATAAGATGAGAAGG - Intronic
1051242248 9:15070971-15070993 GTGTATTTGTAGAAGAGATAAGG - Intergenic
1051417980 9:16862756-16862778 GAGTAGTAGAAGAGAAAAGAGGG - Intronic
1051769843 9:20565502-20565524 GTGTATTAGATTATGAGAGTGGG - Intronic
1052111665 9:24592707-24592729 GTGAATTAGAAAATGTGAGATGG + Intergenic
1052393354 9:27907513-27907535 TTGCATCAGGAGAGGAGAGAAGG - Intergenic
1053072296 9:35108352-35108374 GTGTAAGAGAAGAGAAGAAAAGG + Intronic
1053153699 9:35758963-35758985 GGGTAATAGAAGAGGAAGGAAGG - Intergenic
1053161121 9:35814119-35814141 TTATATTAGAAGCTGAGAGAAGG - Intronic
1053508872 9:38670004-38670026 GGGTCATACAAGAGGAGAGAGGG - Intergenic
1054842340 9:69756728-69756750 GTCTAATAGAAGTGGAGAGGAGG - Intronic
1055485075 9:76748716-76748738 CTGCATTAGAAGAGGTGAGTGGG + Intronic
1055551906 9:77439336-77439358 GTGTATTACAAGAGTGGAGTTGG + Intronic
1055737484 9:79347232-79347254 GTGAAATTGAGGAGGAGAGAGGG - Intergenic
1055960313 9:81814319-81814341 GTGCACAAGAAGAGGAGAAAGGG - Intergenic
1058320876 9:103629188-103629210 ATGGATCAGCAGAGGAGAGAGGG - Intergenic
1058321411 9:103636199-103636221 GTGTAGCAGAGAAGGAGAGAAGG + Intergenic
1058472589 9:105296301-105296323 GGGAATGAGAAGTGGAGAGAGGG - Intronic
1059881889 9:118700139-118700161 CTGTGTTGGAAGAGTAGAGATGG - Intergenic
1059998731 9:119939242-119939264 GTGTAAGAGCAGAGAAGAGAAGG + Intergenic
1061729582 9:132603455-132603477 TTAGATTAGAAGAGGAGAGGAGG + Intronic
1061924599 9:133799813-133799835 GTAGAGTAGGAGAGGAGAGAAGG + Intronic
1061978424 9:134085568-134085590 CAGTATTAGGGGAGGAGAGAAGG - Intergenic
1062699536 9:137891705-137891727 CTGGACTAGAAGAGGTGAGAAGG + Intronic
1185983009 X:4799905-4799927 AGATTTTAGAAGAGGAGAGAAGG + Intergenic
1186140783 X:6571006-6571028 GAATATTAGGAGAGAAGAGACGG - Intergenic
1186892584 X:13973739-13973761 GTGTTTTGGAAGAGGACAAATGG - Intergenic
1187378533 X:18779265-18779287 GTGTATTGGAAGAGGGATGAGGG + Intronic
1187847120 X:23551406-23551428 TTGGAATAGAAGATGAGAGATGG - Intergenic
1187869472 X:23752509-23752531 GTATATGAGGAGAGGAGAGAAGG - Intronic
1189047739 X:37611299-37611321 TTGGAGGAGAAGAGGAGAGAAGG - Intronic
1191184445 X:57593695-57593717 GTTTATTACAAGAGGAGATCGGG - Exonic
1191212944 X:57908764-57908786 GTTTATTACAAGAGGAGATCGGG + Exonic
1191775229 X:64806784-64806806 GAGTAGTAGAAGAGGTCAGAGGG + Intergenic
1192718892 X:73671387-73671409 GAGTTCTAGAAGAGAAGAGATGG - Intronic
1193142344 X:78041222-78041244 ATTTATTAGAAGAGGGGAGAAGG - Intronic
1193698696 X:84739201-84739223 GTCTTTTGGAAGTGGAGAGATGG - Intergenic
1194237631 X:91403888-91403910 GTGTACTACTAGAGGGGAGAGGG + Intergenic
1195058383 X:101169198-101169220 GAATACCAGAAGAGGAGAGAAGG + Intergenic
1196978776 X:121188642-121188664 GTTTGTTAGAGAAGGAGAGAGGG + Intergenic
1198321893 X:135526388-135526410 GTCCATGAGAAGAGAAGAGAGGG - Intronic
1199309323 X:146304591-146304613 GTGTATTGCAAGAAGAAAGAAGG + Intergenic
1199785130 X:151098527-151098549 GTGGAACAGAAGCGGAGAGAAGG + Intergenic
1200132093 X:153855640-153855662 GTGTCAGAGAGGAGGAGAGATGG + Intergenic
1200298998 X:154953327-154953349 CTTTATTAGAAGAGGAGATTAGG + Intronic
1201109720 Y:10790399-10790421 GTGGATTGGACGGGGAGAGAAGG - Intergenic
1201416020 Y:13750430-13750452 GTGTATAAGAATAGGGGAAAGGG + Intergenic
1202110802 Y:21417196-21417218 ATGTAGTAGGAGAAGAGAGAAGG + Intergenic
1202233586 Y:22682524-22682546 ATGTAGTAGAAAAAGAGAGAAGG - Intergenic
1202309570 Y:23513634-23513656 ATGTAGTAGAAAAAGAGAGAAGG + Intergenic
1202561231 Y:26156958-26156980 ATGTAGTAGAAAAAGAGAGAAGG - Intergenic