ID: 1185086556

View in Genome Browser
Species Human (GRCh38)
Location 22:48744047-48744069
Sequence CTCGACAGAACAGCCTTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185086556_1185086563 18 Left 1185086556 22:48744047-48744069 CCTGCCAAGGCTGTTCTGTCGAG No data
Right 1185086563 22:48744088-48744110 CCTGCACTTGTGCAGCCCCACGG 0: 1
1: 0
2: 1
3: 21
4: 189
1185086556_1185086565 24 Left 1185086556 22:48744047-48744069 CCTGCCAAGGCTGTTCTGTCGAG No data
Right 1185086565 22:48744094-48744116 CTTGTGCAGCCCCACGGCACGGG 0: 1
1: 0
2: 2
3: 12
4: 122
1185086556_1185086564 23 Left 1185086556 22:48744047-48744069 CCTGCCAAGGCTGTTCTGTCGAG No data
Right 1185086564 22:48744093-48744115 ACTTGTGCAGCCCCACGGCACGG No data
1185086556_1185086567 26 Left 1185086556 22:48744047-48744069 CCTGCCAAGGCTGTTCTGTCGAG No data
Right 1185086567 22:48744096-48744118 TGTGCAGCCCCACGGCACGGGGG 0: 1
1: 0
2: 0
3: 11
4: 93
1185086556_1185086566 25 Left 1185086556 22:48744047-48744069 CCTGCCAAGGCTGTTCTGTCGAG No data
Right 1185086566 22:48744095-48744117 TTGTGCAGCCCCACGGCACGGGG 0: 1
1: 0
2: 0
3: 5
4: 52
1185086556_1185086568 29 Left 1185086556 22:48744047-48744069 CCTGCCAAGGCTGTTCTGTCGAG No data
Right 1185086568 22:48744099-48744121 GCAGCCCCACGGCACGGGGGTGG 0: 1
1: 0
2: 1
3: 20
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185086556 Original CRISPR CTCGACAGAACAGCCTTGGC AGG (reversed) Intronic
No off target data available for this crispr