ID: 1185086644

View in Genome Browser
Species Human (GRCh38)
Location 22:48744451-48744473
Sequence ATGGCCTGGGGAGGGCCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 307}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185086644_1185086654 1 Left 1185086644 22:48744451-48744473 CCTGGTGGCCCTCCCCAGGCCAT 0: 1
1: 0
2: 0
3: 29
4: 307
Right 1185086654 22:48744475-48744497 ACCCGTGTGGTTCGTGGGATTGG No data
1185086644_1185086657 7 Left 1185086644 22:48744451-48744473 CCTGGTGGCCCTCCCCAGGCCAT 0: 1
1: 0
2: 0
3: 29
4: 307
Right 1185086657 22:48744481-48744503 GTGGTTCGTGGGATTGGAGCCGG 0: 1
1: 0
2: 3
3: 9
4: 108
1185086644_1185086653 -4 Left 1185086644 22:48744451-48744473 CCTGGTGGCCCTCCCCAGGCCAT 0: 1
1: 0
2: 0
3: 29
4: 307
Right 1185086653 22:48744470-48744492 CCATGACCCGTGTGGTTCGTGGG 0: 1
1: 0
2: 0
3: 6
4: 79
1185086644_1185086658 8 Left 1185086644 22:48744451-48744473 CCTGGTGGCCCTCCCCAGGCCAT 0: 1
1: 0
2: 0
3: 29
4: 307
Right 1185086658 22:48744482-48744504 TGGTTCGTGGGATTGGAGCCGGG 0: 1
1: 0
2: 0
3: 9
4: 114
1185086644_1185086651 -5 Left 1185086644 22:48744451-48744473 CCTGGTGGCCCTCCCCAGGCCAT 0: 1
1: 0
2: 0
3: 29
4: 307
Right 1185086651 22:48744469-48744491 GCCATGACCCGTGTGGTTCGTGG 0: 1
1: 0
2: 0
3: 3
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185086644 Original CRISPR ATGGCCTGGGGAGGGCCACC AGG (reversed) Intronic
900195453 1:1373443-1373465 ATTCCCTGGGGAGGCCGACCCGG - Intergenic
900462835 1:2809646-2809668 TTGGCCTGGGAAGTGCCACATGG + Intergenic
901104730 1:6746301-6746323 ATGGTCTGGGGAAAGCCAGCTGG + Intergenic
901772460 1:11537269-11537291 AAGGCCCAGGGAGGGCCACAGGG - Exonic
901879516 1:12185658-12185680 TGGGCCTGGGGTGGGCCTCCGGG + Intronic
902809278 1:18879242-18879264 ATGGCCAGGGGAGGGGTCCCTGG + Intronic
903257405 1:22112100-22112122 ATGGACTGGGAAGGGCTATCAGG - Intergenic
904449553 1:30602073-30602095 CTGGCCTGGGAAGGGCACCCAGG - Intergenic
905267208 1:36762846-36762868 AGGGGATGGGGTGGGCCACCAGG + Intergenic
906047925 1:42846846-42846868 ATGGGTTGGGGACAGCCACCTGG - Intronic
908386168 1:63643794-63643816 AGGGCATGGGGAGGGCATCCTGG + Intronic
908465815 1:64393568-64393590 ATGGGTTGGGCAAGGCCACCAGG + Intergenic
910847763 1:91619735-91619757 ATGGCAAAGGGATGGCCACCAGG - Intergenic
914096030 1:144544994-144545016 ATGTCCTGTGCAGGGGCACCAGG + Intergenic
914302494 1:146388971-146388993 ATGCCCTGTGCAGGGGCACCAGG - Intergenic
915931516 1:160063262-160063284 ATGATCTGGGGAGGGGCTCCTGG + Intronic
916045763 1:160999005-160999027 CTGGGCAGGGGTGGGCCACCTGG - Intronic
916232149 1:162551057-162551079 ATGGCCTGTGGAGGACCACATGG - Intergenic
918746501 1:188208073-188208095 ATGTCCTGGTGAGGGCAATCAGG + Intergenic
920372100 1:205485530-205485552 ATGGCCTGCTGAGGGCCAGACGG - Intergenic
922654948 1:227373873-227373895 ATTTCCGGGGGAGGGCCACTGGG - Intergenic
922721496 1:227902392-227902414 GTGGCCTGGGGAGGTCCTGCGGG + Intergenic
924475733 1:244380763-244380785 ATGGCCTGGGCTGGGCCCCTGGG + Intronic
1067060274 10:43074856-43074878 ATGGGGTGGGGAGGGCCTGCAGG - Intergenic
1067509897 10:46885855-46885877 AGGGGCTGGGGAAGGCCATCTGG + Intergenic
1067652356 10:48166003-48166025 AGGGGCTGGGGAAGGCCATCTGG - Intronic
1067776950 10:49170857-49170879 ATGAGCTGGGGAGGACCCCCTGG + Intronic
1067808580 10:49409930-49409952 CAGACCTGGGGAGGGCCACAGGG - Intergenic
1068868299 10:61917756-61917778 ATGGGGTGGGGAGAGCCACGTGG + Intronic
1069629354 10:69888499-69888521 GTGCCCTGGGGAAGGCCACTGGG - Intronic
1069824116 10:71244882-71244904 GTGGGTTGGGGAGGGCCAGCGGG - Intronic
1069865796 10:71502031-71502053 CTGGCCGGGAGAGGGCCGCCTGG - Intronic
1070823898 10:79379934-79379956 CTGGCCTGGGGAGAGACAGCGGG - Intergenic
1072642466 10:97222427-97222449 ATGGCCAGGGGAGGGCTCCATGG + Exonic
1072724001 10:97800425-97800447 AAGGCCTGTGGAGGGACAGCGGG - Intergenic
1072803747 10:98411038-98411060 ATGGCATGGGGACGGGCAGCGGG - Intronic
1073249867 10:102114813-102114835 GTGGCCTGGGGAGGGCGGGCGGG - Intronic
1074529313 10:114286236-114286258 GTGGCTTCGGGAGCGCCACCAGG + Exonic
1074689661 10:115992712-115992734 GTGGCCTGGGGGAGGACACCGGG - Intergenic
1075767235 10:124903310-124903332 TGGTGCTGGGGAGGGCCACCTGG - Intergenic
1075999471 10:126904147-126904169 AGGGCCTGGGGAGGACCAGGTGG - Intergenic
1076534919 10:131170772-131170794 AGGGACTGGGGAGGGCATCCAGG + Intronic
1076569160 10:131421056-131421078 AGGGCCTGGGCTGGGCCAACAGG - Intergenic
1076627471 10:131830881-131830903 ATGGGCTGTGGAGGGTCAGCGGG + Intergenic
1077205025 11:1337765-1337787 AGGGCCTGGGGGGCGCCTCCGGG + Intergenic
1077318622 11:1930089-1930111 ATGGGCTTGGGAGGCCCAGCAGG + Intronic
1078013377 11:7591722-7591744 CTGGCCTGGGGAGTGGCCCCTGG + Intronic
1079450545 11:20597198-20597220 CTGGGCCGGGGAGGGCCAGCGGG + Intergenic
1081766609 11:45615683-45615705 AGGTCCTGGGGAGGGCCTTCTGG - Intergenic
1083616662 11:64029611-64029633 GTGGGCTGGGAAGGGCCTCCAGG - Intronic
1083650375 11:64200165-64200187 ATGGCCTGGGGATAGTCCCCTGG - Exonic
1083713991 11:64565347-64565369 CTGCCTTGGGGAGGGACACCAGG - Intronic
1083802867 11:65057045-65057067 ATGGCAGGGAGAGGGCCAACAGG + Intronic
1084473417 11:69375968-69375990 TTCGCCTGGGGAGGGCCAGATGG - Intergenic
1084548249 11:69825264-69825286 CTGGGCTGGGCAAGGCCACCAGG - Intergenic
1084564770 11:69922508-69922530 ATGGCCTGGGGGAGGCCACGAGG + Intergenic
1084732102 11:71080264-71080286 GAGGCCTGGGCAGGGGCACCTGG + Intronic
1084876293 11:72136113-72136135 ATGGCCAGGTGAGGGCAGCCTGG + Exonic
1085159264 11:74326023-74326045 AAGGCGTGGGGAGGGGCACATGG - Intergenic
1085271732 11:75273803-75273825 ATGCCTGGGGGAGGGCAACCTGG - Intronic
1085408507 11:76278051-76278073 ATGAACTGGGGAGGCCCACCTGG + Intergenic
1085839267 11:79992358-79992380 ATTGACTGGGAAGGGCCACAGGG + Intergenic
1089146334 11:116331944-116331966 AGGTGCTGGGCAGGGCCACCAGG - Intergenic
1089260649 11:117221759-117221781 CTGGCCTGGGCAGGGCGAGCTGG + Intronic
1089502262 11:118939708-118939730 CTGGCCTGGGGAGGACCTCTGGG - Intronic
1089603885 11:119630556-119630578 ATGGCATGGGCAGGGACACATGG + Intronic
1089642305 11:119855840-119855862 ATGTCCTAGGCAGAGCCACCAGG - Intergenic
1089856197 11:121547172-121547194 CTGGTCTGGGGAGGACTACCTGG - Intronic
1090279709 11:125445346-125445368 ACAGCCTGGGGAGGGTCTCCAGG + Intergenic
1090708616 11:129364180-129364202 ATTGTCTTGGGAAGGCCACCTGG - Intergenic
1091692931 12:2609407-2609429 CTGGCCTGGCGAGGGTCACAAGG - Intronic
1092143885 12:6201450-6201472 CTGGCCTTGGGTGGGCCGCCTGG - Intronic
1094635889 12:32226984-32227006 AGGGCCTGGGGAGGTCCTCGGGG + Intronic
1096561300 12:52437762-52437784 AGGGCCAGGGCGGGGCCACCAGG + Intergenic
1096800018 12:54104272-54104294 ATGGCATGGGGAGGGCGTCCTGG - Intergenic
1098001812 12:65952367-65952389 CTTGCCTGGGAAGGACCACCCGG + Intronic
1099927804 12:89039279-89039301 AAGGGCTGGGCAGGGGCACCAGG + Intergenic
1100698056 12:97117059-97117081 ATTGCCTAGGGAGGGAAACCTGG - Intergenic
1102945111 12:116979937-116979959 AGGGCCTGGGGAGGGACCTCAGG - Intronic
1103321869 12:120096850-120096872 ATGGGCTGGGGAGGGGCGCGGGG + Exonic
1103479044 12:121239115-121239137 ATGGGCTGGGCAGGGGCACGAGG + Exonic
1103848257 12:123914633-123914655 ATGGCCTGGGGGGCATCACCAGG + Intronic
1104049345 12:125185769-125185791 GCGGCCTGGGGATGGCCACCCGG - Intergenic
1104797497 12:131529715-131529737 GTGGCCTGCGGAGGACCCCCAGG - Intergenic
1104840983 12:131825555-131825577 AGCCCCTCGGGAGGGCCACCAGG - Intergenic
1104985384 12:132593664-132593686 AGGGCTTGAGGAGGGCCTCCCGG + Intergenic
1105314914 13:19249203-19249225 ATGGCAAGGGGAGAGCCATCTGG + Intergenic
1109352663 13:61204955-61204977 ATGCCCTGGTCAGGGCCACAAGG + Intergenic
1111237147 13:85423882-85423904 GTGGCTTGGGGATGGCCACCCGG - Intergenic
1111351200 13:87033881-87033903 ATGCTTTGGGGAGGACCACCTGG - Intergenic
1114183215 14:20382250-20382272 AAGGCCTGGGGAAGGACATCAGG + Exonic
1114567708 14:23644753-23644775 AGGGCCCCGGGAAGGCCACCAGG - Intronic
1114746355 14:25152386-25152408 AGGGCCTGGGAAGGGGCACCAGG - Intergenic
1115443988 14:33468213-33468235 AAGCCCTAGGGAAGGCCACCAGG + Intronic
1118362664 14:65069350-65069372 ATGGGAGGGGCAGGGCCACCAGG - Intronic
1119433857 14:74585506-74585528 CTCGCCTGGGGTGGCCCACCTGG + Intronic
1121336941 14:93083381-93083403 CTGCCCTGGGGAGGGCCTCTTGG - Intronic
1122358029 14:101135972-101135994 ATGCCCTGGCTAGTGCCACCAGG + Intergenic
1123056774 14:105574599-105574621 ATGGCCAAGGGAGAGCCACATGG - Intergenic
1123081435 14:105697186-105697208 ATGGCCAAGGGAGAGCCACATGG + Intergenic
1123412836 15:20073802-20073824 ATATCCTGGGCAGGGCCTCCAGG + Intergenic
1123522178 15:21080915-21080937 ATATCCTGGGCAGGGCCTCCAGG + Intergenic
1124412982 15:29451843-29451865 AAGGCCTGGGGAGGACCCTCTGG - Intronic
1124425397 15:29558543-29558565 ATTGCCTGGGAAGCCCCACCTGG - Intronic
1125450797 15:39804924-39804946 ATGGTCTGGGGATGGGCACAAGG + Intronic
1126146627 15:45479472-45479494 ATAGACTGGTGAGGACCACCAGG - Intergenic
1126580957 15:50242267-50242289 ATGGCCTGCAGAGGGCAACAGGG + Exonic
1128155348 15:65388540-65388562 ATGGCCTGGAGAGCGACACTCGG - Exonic
1129265530 15:74391377-74391399 TTGGGCTTGGGAGGGCCTCCAGG - Intergenic
1129865238 15:78902418-78902440 TGGGCCTGGGGGGGGCCACTGGG + Intergenic
1129912563 15:79240552-79240574 AGTGCCTGGGGAGGGCTGCCTGG - Intergenic
1131550040 15:93349499-93349521 AAGACCTGGGCAGGACCACCAGG - Intergenic
1131989811 15:98082426-98082448 ATGGCAAAGGGATGGCCACCAGG + Intergenic
1132313140 15:100871585-100871607 ATGGTATGAGAAGGGCCACCAGG - Intergenic
1132321802 15:100930729-100930751 GGGGCCTGGGGAGGCCCACATGG - Intronic
1132544914 16:528464-528486 ACGGCCTGGGGGCGGCCACCTGG + Intronic
1132555091 16:568821-568843 GAGGCCTGGGCAGGGGCACCTGG - Exonic
1132593147 16:735204-735226 GTGCCCTAGGGAGGGTCACCGGG - Intronic
1132611631 16:819641-819663 CTGGCCTGGGGAGGCCCTCTGGG + Intergenic
1132711648 16:1271547-1271569 AGGGCCTGGGGATGGCCGTCGGG + Intergenic
1132711694 16:1271715-1271737 AGGGCCTGGGGACGGCCGTCGGG + Intergenic
1132711717 16:1271799-1271821 AGGGCCTGGGGATGGCCGTCGGG + Intergenic
1133279891 16:4659375-4659397 AGGGGCTGGGGAGGGACCCCAGG - Intronic
1134110776 16:11514321-11514343 ACGGCCAGGGGGTGGCCACCAGG + Intronic
1136419206 16:30122061-30122083 AAGGCCTGGGTGGGGCCACCAGG - Intronic
1136470098 16:30474090-30474112 GTGGCCTGGGGAGCGACATCCGG + Intronic
1139355310 16:66364119-66364141 AAGGCCTGGGGACGCCCACCTGG - Intergenic
1139891307 16:70254730-70254752 AGGGCCTGGGAGGGGACACCGGG + Exonic
1140248015 16:73268801-73268823 ATGTCCCAGGGATGGCCACCAGG - Intergenic
1140476681 16:75242570-75242592 ATATCCTGGGCAGGGCCTCCAGG + Exonic
1140840683 16:78836275-78836297 GTGGCCTAGGGAGGGACAACTGG + Intronic
1141400214 16:83740804-83740826 GTGGCCTGGGCAGGGCCTCTTGG - Intronic
1141447464 16:84070683-84070705 ATGGCCTTGGTCGGGCTACCTGG - Exonic
1141469089 16:84226361-84226383 ATGGCCTGTGAAGGGCCACGAGG + Intronic
1143865139 17:9917942-9917964 GGGGCCTGGGGAGAGCCGCCTGG - Intronic
1144037627 17:11381749-11381771 ATGGGCAGGGGAGGGTCTCCTGG - Intronic
1144639684 17:16930601-16930623 CTGGCCTGGAGGGGGCCACTCGG + Intronic
1150494856 17:65599515-65599537 ATGGCTTGGCCACGGCCACCTGG - Intronic
1150521531 17:65871788-65871810 ATATCTTGGGGAGGCCCACCTGG - Intronic
1151559428 17:74862535-74862557 CTGGACTGTGGAGGGTCACCAGG - Exonic
1151596039 17:75078476-75078498 ATGGCCTGGCCAGGGTCCCCTGG - Intergenic
1151716362 17:75833041-75833063 ATGGCCTGGGGAGGGAGATGGGG + Exonic
1152190550 17:78885034-78885056 ATGGGCTGAGGGGGGCCAGCAGG - Intronic
1152304173 17:79511652-79511674 ATGGCCAGGGGACACCCACCCGG + Intronic
1152304237 17:79511902-79511924 ATGGCCAGGGGACACCCACCCGG + Intronic
1152304252 17:79511952-79511974 ATGGCCAGGGGACACCCACCCGG + Intronic
1152304302 17:79512152-79512174 ATGGCCAGGGGACACCCACCCGG + Intronic
1152304317 17:79512202-79512224 ATGGCCAGGGGACGCACACCCGG + Intronic
1152304354 17:79512352-79512374 ATGGCCAGGGGACACCCACCCGG + Intronic
1152304419 17:79512602-79512624 ATGGCCAGGGGACGCACACCCGG + Intronic
1152304434 17:79512652-79512674 ATGGCCAGGGGACACCCACCCGG + Intronic
1152304466 17:79512752-79512774 ATGGCCAGGGGACACCCACCCGG + Intronic
1152304483 17:79512802-79512824 ATGGCCAGGGGACGCACACCCGG + Intronic
1152304497 17:79512852-79512874 ATGGCCAGGGGACGCACACCCGG + Intronic
1152304537 17:79513002-79513024 ATGGCCAGGGGACACCCACCCGG + Intronic
1152472892 17:80500116-80500138 ATGGGCTGGCCATGGCCACCTGG - Intergenic
1152732468 17:81979065-81979087 TTTGCCTGGGCAGAGCCACCTGG + Intronic
1152743422 17:82028535-82028557 GGGGCCTGGGGATGGGCACCGGG + Intronic
1152878325 17:82801014-82801036 GGTGCCTGGGGAGGGCCACGGGG + Intronic
1153834290 18:8950252-8950274 AAGGCCTGGGGAGGGGCCCGTGG - Intergenic
1153953966 18:10080536-10080558 GCGGCCTGAGGCGGGCCACCTGG - Intergenic
1157248126 18:46071548-46071570 ATGGCCTGGGGAGGGGGCTCGGG + Intronic
1157563408 18:48664013-48664035 GAGGCATGGGGAGGGCCCCCGGG + Intronic
1157590896 18:48835986-48836008 GTGGCCTGGGGACAGGCACCGGG + Intronic
1158350938 18:56563823-56563845 ACAGTCTGGTGAGGGCCACCAGG - Intergenic
1158893356 18:61893450-61893472 ATGGCTTGGGGAGCGCTGCCTGG - Exonic
1159869262 18:73742107-73742129 ATATCCTGGGAAGGGCCAGCTGG - Intergenic
1160771069 19:831482-831504 ATTGCCAGGGGAGGGGCACCTGG + Intronic
1161016702 19:1987004-1987026 CAGGCCTGGGGAGGGCCAACGGG + Intronic
1161120162 19:2521349-2521371 ATGGACTGAGGCAGGCCACCCGG - Intronic
1161769583 19:6223969-6223991 AGGCCCTGGGGAGGGGCTCCGGG + Intronic
1161838374 19:6663233-6663255 CTGGGCTGGGGAGGGCCCTCAGG + Intronic
1161963291 19:7534585-7534607 CGGGCCTGGGGAGGGCGTCCGGG - Intronic
1163152833 19:15425086-15425108 CTGGCCTGGGCAGGGCCATCTGG - Intronic
1163531300 19:17850544-17850566 ATGGCGTGGGTAGGGCCGCGTGG + Intergenic
1163720033 19:18894507-18894529 AGGGGCTGGGGAGGGCCCCCGGG + Intronic
1164438275 19:28251229-28251251 ATGACCTGGACAAGGCCACCTGG + Intergenic
1164532100 19:29056559-29056581 TTAGTCAGGGGAGGGCCACCTGG - Intergenic
1164927136 19:32139481-32139503 ATGGGCTGGGGAGGAGCATCAGG - Intergenic
1165333430 19:35154062-35154084 AAGGCCTGGAGAGGGACAGCAGG - Exonic
1166984713 19:46652885-46652907 ATGGCGTGGGGAGAGACACAGGG + Intronic
925277130 2:2657998-2658020 AAGGCCTGGGGAGAACCCCCTGG + Intergenic
925306891 2:2854122-2854144 AAGGCCTGGAGAGAGCCACTGGG + Intergenic
925340523 2:3132493-3132515 CAGGCCTGGGTAGGGCCGCCCGG - Intergenic
925853833 2:8110334-8110356 ATGCCCCTGGGAGGGCGACCTGG - Intergenic
926425077 2:12732730-12732752 AGGGCCTGGGAAGGACCACCTGG - Intronic
926620358 2:15041547-15041569 AATGCCTGGGGAGGGCCGGCAGG + Intergenic
927433503 2:23047448-23047470 AGGGACTGGGCAGGGTCACCTGG - Intergenic
927885300 2:26714547-26714569 ATGGCCTGGGGAGGACAGGCAGG - Intronic
928091722 2:28378618-28378640 ATGGCAGGGGGAGGGTCACTGGG + Intergenic
929433381 2:41907585-41907607 ATGACCTGGTTAGGGCCACAAGG + Intergenic
932195294 2:69777808-69777830 CTGGCCTGGGCAGGGCGATCCGG - Intronic
932281752 2:70498952-70498974 AGGGCCTGGGGATGGCATCCAGG - Intronic
933702182 2:85263354-85263376 CTGGCCTGGGGAGGGGCTGCCGG + Intronic
934619653 2:95796471-95796493 ACAGCCTGGGGAGGGACACCAGG - Intergenic
934641235 2:96028086-96028108 ACAGCCTGGGGAGGGACACCAGG + Exonic
934663088 2:96153530-96153552 ATGGGCTGCGGAGGGGCAGCTGG - Intergenic
937111636 2:119371170-119371192 AGGAACTGGGGAGGGCCACTGGG - Intronic
937223231 2:120353783-120353805 ATGGCCTGGGCTGGGGCACTGGG + Intergenic
937514746 2:122640632-122640654 CTGGGCTGGAGAGGGGCACCTGG + Intergenic
942212096 2:173681472-173681494 ATGACATGGGGAGGCCCACATGG - Intergenic
943369776 2:187002388-187002410 ATGGCCTGCGGTGGGCCCCAGGG - Intergenic
945907247 2:215608082-215608104 AAGGCCTGGGGAGGAACACAGGG + Intergenic
946990280 2:225321536-225321558 ATGGGCTGTGGAGAGACACCTGG - Intergenic
947791375 2:232871234-232871256 ATGGCCTGGGGAGAGCTTCTGGG + Intronic
948422694 2:237870269-237870291 ATGGCCTGCCCAGGGTCACCAGG - Intronic
948465622 2:238150364-238150386 ATGGCCTTGGGAGTGCCCCTGGG - Intronic
1168800764 20:642286-642308 GTTGCCTGGGGGGGGCCAGCGGG + Intergenic
1168800808 20:642377-642399 GTTGCCTGGGGGGGGCCAGCGGG + Intergenic
1168800822 20:642406-642428 GTTGCCTGGGGGGGGCCAGCGGG + Intergenic
1168987482 20:2062674-2062696 ATTGCCTGGGAAGGGGCACGAGG + Intergenic
1169262947 20:4150769-4150791 AAGGCCTGGGGAGTGCCATCAGG - Intronic
1170989304 20:21287466-21287488 ATGGCCTGTCCAGGGCCACTTGG + Intergenic
1171424442 20:25040824-25040846 GTGGCCTGGGGTGGGGCATCTGG - Intronic
1171796426 20:29570070-29570092 ATGGCATGGGGAGGGTGTCCTGG + Intergenic
1171851811 20:30314098-30314120 ATGGCATGGGGAGGGTGACCTGG - Intergenic
1172190750 20:33060522-33060544 AAGGTGTAGGGAGGGCCACCTGG - Intronic
1172292020 20:33783675-33783697 ATGGCCAGGGGAGGGGGGCCCGG + Intronic
1172526665 20:35603948-35603970 CAGGCCTGGGGAGGCCCAGCTGG - Intergenic
1173334398 20:42101115-42101137 ATGGGCTGGGGAGGGGAAGCTGG + Intronic
1173660072 20:44727177-44727199 GTGGGCTGGGCATGGCCACCCGG + Exonic
1174048110 20:47748135-47748157 ATGGCCTGCTGGGGACCACCAGG + Intronic
1174111729 20:48202006-48202028 AAGGCCTGGGGATGGTCCCCAGG + Intergenic
1174169408 20:48606826-48606848 AGGGCCTGGGGATGGTCCCCAGG - Intergenic
1174850559 20:53989974-53989996 ATTTCATGGGCAGGGCCACCAGG - Intronic
1175223242 20:57429522-57429544 ATGGCCTTGGAAGGGACAGCCGG - Intergenic
1175743318 20:61435879-61435901 ATGTGCTGGGGAGGGGCTCCAGG + Intronic
1175831052 20:61965736-61965758 AAGGCCCGGGGCGGGGCACCTGG - Intronic
1175891312 20:62317272-62317294 AGGGCCTTGGGAGGGCCAGCTGG - Intronic
1175910223 20:62401744-62401766 AGGGGCTGAGGAGGGGCACCAGG + Intronic
1176084896 20:63291411-63291433 ATGGCCAGAGGAGGGCGCCCAGG - Intergenic
1176142190 20:63549672-63549694 ATGGCCTGAGGAGGCCTCCCTGG - Intronic
1178894849 21:36549796-36549818 GTGGCCAGGGGAGGGTCCCCAGG - Intronic
1179945456 21:44671066-44671088 ATGGGTTGGGGGGGACCACCAGG - Intronic
1182294783 22:29306600-29306622 CTGGCCAGGGGAGGTCCACCCGG + Intronic
1182302128 22:29342852-29342874 GGGGCCGGTGGAGGGCCACCAGG - Intronic
1182323075 22:29490898-29490920 ATCGCCTGGGGAGGGCCTGGGGG - Exonic
1182630970 22:31685087-31685109 GTGGCCTAGGGAGGGGGACCTGG - Exonic
1183060959 22:35336174-35336196 AAGCCCTGGGGAGGGCCTGCAGG - Intronic
1183746988 22:39697763-39697785 AGGGCCTGGGGAGAGACACAGGG + Intergenic
1183975854 22:41511807-41511829 AGGGCTTGGTGAGGGTCACCTGG + Intronic
1184522318 22:45002455-45002477 AAGGCTGGGGGAGGGTCACCTGG + Intronic
1184758392 22:46530774-46530796 AGGGCCTGGGAAGGCCCACGTGG - Intronic
1184765527 22:46570159-46570181 AGGGCCTGGCGGGGGACACCGGG + Intergenic
1185086644 22:48744451-48744473 ATGGCCTGGGGAGGGCCACCAGG - Intronic
950156760 3:10726847-10726869 AAGGCCTGGAGAGGGTCATCTGG - Intergenic
950419001 3:12885754-12885776 GTGGCCTGGGGAGCCCCACATGG - Intergenic
950442276 3:13017148-13017170 ATGGCCTGGGGAGGTCAAGAAGG - Intronic
950582295 3:13870544-13870566 ATGGTCTGGGTGGGGCTACCAGG + Intronic
953877898 3:46676792-46676814 GTGGGCTGGGGAGGGCTTCCTGG - Intronic
954130961 3:48560790-48560812 AGGGCCTGGGCAGCGCCAGCTGG + Intronic
954378507 3:50207108-50207130 GTGGTGTGGGGTGGGCCACCAGG + Intronic
954798405 3:53173132-53173154 ATGGCCTGAGGAGCGCCAGCAGG - Intronic
954999791 3:54916975-54916997 ATGGCCTCTGGAGGGACAGCTGG + Intronic
955027407 3:55183042-55183064 ATGGCATGGGGACTGCCAACTGG - Intergenic
960697067 3:120406603-120406625 CTGGCCTGGGGAGGCCCAACTGG - Intronic
961406300 3:126682173-126682195 CTGGCCTGGGAAGAGCCCCCTGG - Intergenic
961539034 3:127588127-127588149 GAGGCCTGGAGAGGGGCACCTGG - Intronic
961831713 3:129626515-129626537 ACTGACTGGGAAGGGCCACCAGG + Intergenic
963636141 3:147798979-147799001 ATGGTGTGGAGAGGGCCATCTGG + Intergenic
967375747 3:188798567-188798589 ATGTCCAGGGCAGAGCCACCAGG - Intronic
968880266 4:3294963-3294985 ATGTCCTGGGGAGGGTCAGGAGG + Intronic
968914793 4:3492670-3492692 CTGGCCTGTGGGGGTCCACCAGG + Intronic
969301615 4:6300474-6300496 CGAGCATGGGGAGGGCCACCTGG + Intronic
969432032 4:7161023-7161045 CTGGCCTGGGCATTGCCACCAGG - Intergenic
969526856 4:7708299-7708321 ATGGCCTGGGAAGGCCAGCCGGG - Intronic
969627577 4:8315538-8315560 ACGGTCTAGGGAGGGCCTCCTGG + Intergenic
972812724 4:42608334-42608356 ATTGCCCGGGGAGGGCACCCCGG - Intronic
975099276 4:70493744-70493766 AAGGCCTGGGAAGGTCCCCCAGG - Intergenic
977890122 4:102299909-102299931 CTGGGCTGGGGAGCCCCACCCGG + Intronic
979131694 4:117055309-117055331 ATGGACTGGGGAGCTCCTCCAGG + Intergenic
985984684 5:3504603-3504625 ATGGCCAGGGGAGGGTCTCAGGG + Intergenic
986406149 5:7426853-7426875 ATGGCCATGGGAGGCTCACCAGG + Intronic
987605395 5:20128071-20128093 ATGTCCTAGGGAGGCCCACTGGG - Intronic
991275861 5:64845199-64845221 TTAGCCTGGGAAGGGCCAGCTGG - Intronic
994165797 5:96606889-96606911 TTGGCCTGGGGAGGGCCCCAAGG - Intronic
1001119485 5:168968014-168968036 AAGGCCTGGGGAGAGCCATGAGG - Intronic
1001600324 5:172924135-172924157 ATGGCCGGGGGTGGGCCTTCAGG + Intronic
1001964478 5:175900720-175900742 ATGGAATGGGGAGGGCTCCCAGG + Intergenic
1001986366 5:176076750-176076772 ATGACCTTGTGAGGGTCACCAGG - Intronic
1002230501 5:177761374-177761396 ATGACCTTGTGAGGGTCACCAGG + Intronic
1002264835 5:178022374-178022396 ATGACCTTGTGAGGGTCACCAGG - Intronic
1002399734 5:178984911-178984933 ATGGCTTGGGGAGGGTGACCTGG - Intronic
1006342076 6:33452511-33452533 ATGGGGTGGAGGGGGCCACCGGG + Exonic
1007935436 6:45728223-45728245 ATGGCTTGGGGATCACCACCTGG - Intergenic
1008414096 6:51219229-51219251 ATTGCCTGAGGAGGGAAACCAGG - Intergenic
1011861709 6:91765812-91765834 ATGGACTGATAAGGGCCACCTGG + Intergenic
1019748234 7:2712570-2712592 ATGGCCTCCGCAGGGCCCCCAGG - Exonic
1019918850 7:4150235-4150257 CCTGCCTGGGCAGGGCCACCCGG + Intronic
1022975352 7:35550986-35551008 ATGGCTTGGGGAGGGACCCAGGG + Intergenic
1023879365 7:44309531-44309553 AGGGCATGGGGAGGGCCCTCGGG + Intronic
1024001125 7:45189938-45189960 ATGGCCAGGAGTGGGCCTCCTGG - Intergenic
1024042973 7:45569106-45569128 GGGGTCTGGGGAGGGCCACTGGG - Intergenic
1024785861 7:52906690-52906712 AAGGCCTGAGGATGGCTACCTGG - Intergenic
1027255944 7:76430875-76430897 ATGGCCTGGGCAGAGCCATGTGG + Intronic
1029501581 7:100933948-100933970 ATGGGCTGGGCAGGGCTCCCTGG - Intergenic
1032883790 7:136116397-136116419 ATGGTCTTGGGAGGGCCAGCAGG + Intergenic
1035732922 8:1865432-1865454 ATGCCCTGGTGATGGCCCCCTGG - Intronic
1037487739 8:19364372-19364394 ATGGGGTGTGGAGGGCCAACTGG + Intronic
1038520680 8:28229734-28229756 AAGGCCTGGGGAGGGTGTCCAGG + Intergenic
1045546696 8:103135678-103135700 ATGGCCTGGAGAGGAAAACCCGG - Intronic
1046871430 8:119208830-119208852 ATTGCCTGGGGAGGGCGAGTAGG + Intronic
1048917482 8:139198884-139198906 ATGGCTTGGGGAACTCCACCTGG + Intergenic
1049208851 8:141376139-141376161 ATGCCCTACGTAGGGCCACCTGG - Intergenic
1049461162 8:142728463-142728485 GGGCCCTGGGGACGGCCACCAGG + Intronic
1049587739 8:143439899-143439921 ATGGCCTGGCTCGGGCCCCCAGG - Intronic
1052422605 9:28263153-28263175 ATGGTGTGGAGAGGGCCATCTGG - Intronic
1053025470 9:34725241-34725263 GTGGCCTGGGGATGGACACTGGG + Exonic
1053036999 9:34834303-34834325 GTGGCCTGGGGATGGACACTGGG + Intergenic
1053396980 9:37784521-37784543 ATAGCCTGAGAAGGGCGACCAGG - Intronic
1053420367 9:37973738-37973760 TTGGCCAGGGGAGGGTCATCTGG + Intronic
1053789594 9:41677352-41677374 ATGGCATGGGGAGGGTGTCCTGG - Intergenic
1054177932 9:61889043-61889065 ATGGCATGGGGAGGGTGTCCTGG - Intergenic
1054659597 9:67691781-67691803 ATGGCATGGGGAGGGTGTCCTGG + Intergenic
1056470105 9:86897397-86897419 ATGGCCCGGACAGGGTCACCTGG - Intergenic
1060400131 9:123343879-123343901 ATGTCCTTGGGAGATCCACCTGG + Intergenic
1060539485 9:124419935-124419957 AGGCCCAGGGGAGGGCCAGCTGG - Intergenic
1060540886 9:124429347-124429369 GTGGCCTTGGGCGAGCCACCTGG + Intergenic
1060977073 9:127771149-127771171 TGGGCCTGGGGAGGGCCAGCGGG - Intronic
1061400845 9:130367546-130367568 GTGGCCTGAGGAGGGTGACCAGG - Intronic
1061645104 9:131994809-131994831 ATGAGCTGGGGAGGGCCACTGGG - Intronic
1061946028 9:133908529-133908551 ATGGGCTGGGGGTGGACACCAGG - Intronic
1062058891 9:134483954-134483976 GTGCCCTGGAGAAGGCCACCTGG - Intergenic
1062268098 9:135696559-135696581 TTGGCCTGGGGAGCGGCGCCAGG - Intronic
1062271710 9:135712901-135712923 GTGGCCTGGGGAGGGTGACAAGG - Intronic
1062541015 9:137041581-137041603 ATGACCTGGGGAGGGGTCCCGGG - Intronic
1185566027 X:1096079-1096101 ATGGCCGGGGGAGGCCTTCCTGG + Intergenic
1186587998 X:10897558-10897580 TTGGCCTGGGGTGGGACACAGGG - Intergenic
1190886918 X:54538592-54538614 ATGGCCTGAGCAGGGTCAGCAGG + Intronic
1194543742 X:95206132-95206154 GAGGCCTGGGGAGGCCTACCTGG + Intergenic
1197064400 X:122221151-122221173 CTGGTCTGGTGAGGGACACCTGG + Intergenic
1197757398 X:130005396-130005418 AGGGCCTGGGGAGGGACCCTGGG + Intronic
1198599946 X:138271681-138271703 ATGGCATGGGCAGGGCCTGCTGG - Intergenic
1198949916 X:142058626-142058648 ATGGCAAGGGGAGAGCCATCTGG + Intergenic
1200072028 X:153533923-153533945 CATGCCAGGGGAGGGCCACCAGG + Intronic
1200082985 X:153588540-153588562 ATGGGCAGGGGAGGGGCACAGGG + Intronic
1200282778 X:154792203-154792225 TTGACCTGGGCAGGGCTACCTGG + Exonic