ID: 1185086651

View in Genome Browser
Species Human (GRCh38)
Location 22:48744469-48744491
Sequence GCCATGACCCGTGTGGTTCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 43}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185086644_1185086651 -5 Left 1185086644 22:48744451-48744473 CCTGGTGGCCCTCCCCAGGCCAT 0: 1
1: 0
2: 0
3: 29
4: 307
Right 1185086651 22:48744469-48744491 GCCATGACCCGTGTGGTTCGTGG 0: 1
1: 0
2: 0
3: 3
4: 43
1185086641_1185086651 11 Left 1185086641 22:48744435-48744457 CCTGGAGGCATCGATACCTGGTG 0: 1
1: 0
2: 1
3: 1
4: 67
Right 1185086651 22:48744469-48744491 GCCATGACCCGTGTGGTTCGTGG 0: 1
1: 0
2: 0
3: 3
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185086651 Original CRISPR GCCATGACCCGTGTGGTTCG TGG Intronic
902931749 1:19736347-19736369 CCCATGACCCATGTGGATTGTGG + Intronic
907749655 1:57250207-57250229 GCCATGGACCATGTGGTTTGTGG + Intronic
1076758417 10:132587426-132587448 GGCATGGCCTGTGTGATTCGAGG + Intronic
1077143026 11:1033195-1033217 TCCATGGCCCGTGGGGCTCGAGG + Intronic
1083997187 11:66278345-66278367 GGCATGGCCCGTGGGGCTCGGGG - Exonic
1102602815 12:114045609-114045631 GCCATGACGGGTGTGCTTCCAGG - Intergenic
1103987408 12:124777267-124777289 GACATGCCCCGTGTTGTTCTAGG - Intronic
1125812092 15:42550156-42550178 TCCAGGACCCATGTGGTCCGCGG - Intronic
1134006578 16:10822237-10822259 GCCAAGACCAGTGTGGGTAGGGG - Intergenic
1138093389 16:54194338-54194360 GCCATGGCCCGTGTGGCCCGGGG - Intergenic
1139059875 16:63236936-63236958 ACCATGAGCCGCTTGGTTCGTGG - Intergenic
1142000432 16:87661220-87661242 ACAAGGACCCTTGTGGTTCGGGG + Intronic
1148348229 17:46918691-46918713 CCAATGACCCTTGTGGTTCAGGG - Intergenic
1155515843 18:26623383-26623405 CCCATGACACGTGTGTATCGTGG - Intronic
1157196457 18:45624013-45624035 GCCCTGACCCTGGTGGTACGGGG + Intronic
1163513834 19:17751358-17751380 CCCATGGCCTGTGTGGTTCCAGG + Intronic
1166471605 19:43083509-43083531 GCCATGTCCCGCGGGGTTCCTGG - Intronic
1166482749 19:43187325-43187347 GCCATGTCCCGCGGGGTTCCTGG - Intronic
1166485223 19:43206459-43206481 GCCATGTCCCGCGGGGTTCCTGG - Intronic
1166492373 19:43270377-43270399 GCCATGTCCCGCGGGGTTCCTGG - Intergenic
931231069 2:60375365-60375387 CCCCTGACCCCTGTGGTTGGGGG + Intergenic
935846953 2:107176223-107176245 GCCATGACTCCTGTGGTTGTTGG + Intergenic
947238696 2:227971031-227971053 GCCATGACCCATGTGGCCCTTGG + Intergenic
1184245093 22:43231720-43231742 GCCATGCCCCGGGTGGCTCTCGG - Intronic
1185086651 22:48744469-48744491 GCCATGACCCGTGTGGTTCGTGG + Intronic
955753921 3:62208945-62208967 GCCATGGGCCGTGTGGCTCTGGG - Intronic
969441490 4:7219719-7219741 CCCATGACACGTGGGGATCGTGG + Intronic
970344560 4:15141007-15141029 GACATGAGCCGTGTGGCTCTGGG - Intergenic
981051042 4:140309813-140309835 GCCATGAGCTGTGGGGTTTGGGG - Intronic
988683021 5:33502207-33502229 GCCAGGACCAGTGTGGGTCGAGG + Intergenic
988913342 5:35868526-35868548 GCCATGACCAGTGTGGGTCCTGG + Intronic
1002508645 5:179698589-179698611 GCCCTCACCCGTCTGGTTCCTGG - Intronic
1005271964 6:24175531-24175553 GTCATGGCCTGTGTGGTTTGGGG - Intronic
1010152269 6:72747155-72747177 GCCATAACCCCTGAGGTTTGTGG - Intronic
1020005970 7:4783956-4783978 CCCCTGACCCGTGTGGCTCTGGG + Intronic
1024204962 7:47150077-47150099 GCCATTACCTGTGTGGTTTTAGG - Intergenic
1035654709 8:1296824-1296846 GCACTGTCCTGTGTGGTTCGGGG - Intergenic
1038345057 8:26725093-26725115 CCCATGACACGTGGGGATCGTGG - Intergenic
1046689067 8:117262462-117262484 GTCCTGTCCCGTGTGGTTAGTGG - Intergenic
1049844165 8:144792110-144792132 GCCATGGGCCGTGTGATCCGTGG - Exonic
1062563884 9:137155277-137155299 GCCATGACACGTGTGGTGTTGGG + Intronic
1188541904 X:31260156-31260178 GCCATGAGCCCAGGGGTTCGAGG + Intronic
1189462473 X:41253557-41253579 ACCTTGACCCGTGGGGGTCGTGG + Intergenic
1190708413 X:53048936-53048958 GCCATGGCCCGTGTGCTCCCAGG + Intergenic
1193351499 X:80469903-80469925 TCCAGGACTCGTGTCGTTCGAGG - Intergenic
1202370239 Y:24191288-24191310 CCCATGACCCCTGTGCTTCCCGG - Intergenic
1202500545 Y:25478829-25478851 CCCATGACCCCTGTGCTTCCCGG + Intergenic