ID: 1185088128

View in Genome Browser
Species Human (GRCh38)
Location 22:48751731-48751753
Sequence CTGGCAGAGGCTGCCGGCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 489
Summary {0: 1, 1: 0, 2: 3, 3: 43, 4: 442}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185088128_1185088132 -8 Left 1185088128 22:48751731-48751753 CCCGGGCCGGCAGCCTCTGCCAG 0: 1
1: 0
2: 3
3: 43
4: 442
Right 1185088132 22:48751746-48751768 TCTGCCAGCCAGCGTCCTCACGG 0: 1
1: 0
2: 0
3: 16
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185088128 Original CRISPR CTGGCAGAGGCTGCCGGCCC GGG (reversed) Intronic
900147603 1:1165261-1165283 CCAGCTGAGCCTGCCGGCCCAGG + Intergenic
900189092 1:1345782-1345804 CTGGCAGGGGTAGCTGGCCCAGG + Intronic
900297067 1:1957245-1957267 CTGGCTAAGGATGCAGGCCCGGG + Intronic
900399527 1:2467339-2467361 CCAGCAGAGGCTGCTGGGCCCGG + Intronic
900534785 1:3171497-3171519 CTGGCAGAGGTGGCCATCCCAGG + Intronic
900567612 1:3341321-3341343 CCTTCAGAGGCTGCAGGCCCTGG + Intronic
900640740 1:3687055-3687077 CAGGCAAAGGCAGCAGGCCCTGG - Intronic
900992759 1:6105562-6105584 CAGCCACAGGCTGCCGGGCCAGG + Intronic
901051312 1:6427110-6427132 CTGGCAGAGGCGGCAGGAGCTGG - Intronic
901551321 1:9997742-9997764 CGGGCAGAGGCTTCGGTCCCGGG - Intronic
902169591 1:14599139-14599161 CTGGCCGCGGCTCCCGGGCCCGG - Exonic
902775279 1:18670717-18670739 CCGGCAGGGGCTGCAGGCCATGG + Intronic
902916634 1:19643928-19643950 CTGGCACGGCCTGACGGCCCAGG + Intronic
903447758 1:23433245-23433267 CTTGCTGAAGCTCCCGGCCCAGG - Exonic
903791886 1:25898808-25898830 ATGGCAGAGAATGCCGGGCCCGG + Intronic
903884419 1:26532574-26532596 CTGGCAGTGCCAGCCAGCCCTGG + Intronic
904038680 1:27572013-27572035 CTGGCAGGAGCTGAGGGCCCAGG - Intronic
904600432 1:31669847-31669869 CTGGCAGAAGGAGCCGGCCAAGG + Intronic
904676044 1:32199845-32199867 CTGGCAGAGGCTCCTGGCGCAGG - Intergenic
904744259 1:32701745-32701767 GTGGCAGAGGCAGGCTGCCCAGG - Intronic
906208524 1:43999639-43999661 CTGGCACAGGCTCCCCGCTCTGG - Intronic
908780492 1:67685787-67685809 CTGCCACAGGCTGCCAGCCACGG - Intronic
912160394 1:106976056-106976078 CTGGCAGTGGGTTCCTGCCCAGG - Intergenic
912686881 1:111774897-111774919 CCGGCTGAGGCTGCGAGCCCTGG + Intronic
915104117 1:153521884-153521906 CCGGCAGGCCCTGCCGGCCCCGG + Intergenic
915865568 1:159494871-159494893 CTGGCCGGCCCTGCCGGCCCCGG - Intergenic
917028623 1:170666680-170666702 CTGGCCGAGGCCGCTGGCCTTGG - Intronic
917855077 1:179093083-179093105 CTGGCTGAGGCTGCAGCCCAGGG + Intronic
918361172 1:183759515-183759537 CTGGGAGAGACTGCCTTCCCTGG - Intronic
919453800 1:197800580-197800602 GTGGCAGAGGCTTCAGGCCTGGG - Intergenic
919851728 1:201677432-201677454 TGGGCAGAGGCTGCTGGCCTTGG - Intronic
920456945 1:206108851-206108873 CTGGGAGAGGCTGCAGGCCAAGG - Intergenic
920700173 1:208212016-208212038 GTGGCAAAGGCTGCAGGCTCTGG + Intronic
920972921 1:210757951-210757973 CTGGAGGAGGCTGTCAGCCCAGG - Intronic
921120229 1:212130011-212130033 CTGGCAAGGGCTTCCGGCCAAGG + Intergenic
921706200 1:218324384-218324406 ATGGCAGAGGCTCCGGGCCTGGG + Intronic
921850940 1:219931320-219931342 GTGGCAGAGGCAGCCTGCCTGGG + Intronic
922425161 1:225485499-225485521 CTGGCTGAGGCTCCCCACCCAGG - Intergenic
922859451 1:228803575-228803597 CTGGCTGCGGCTGCTGGACCTGG + Intergenic
923009984 1:230081028-230081050 CTGGCAGAGGAGGCTGGCTCTGG - Intronic
923810532 1:237309889-237309911 CTGGCTGGCACTGCCGGCCCCGG - Intronic
924946034 1:248847625-248847647 CTGGCAGATGCTGGCGGCGCCGG - Exonic
1066064089 10:31750004-31750026 CAGGCAGGGGGTGCCGGCCGTGG - Intergenic
1067066176 10:43105476-43105498 CCGGCAGATGCTCCCCGCCCGGG - Intronic
1067564237 10:47325456-47325478 TTGACAGTGGCTGCCAGCCCCGG - Exonic
1070147585 10:73785973-73785995 CTGGCAGAGGCTCTCGGCCTCGG - Exonic
1070799380 10:79236161-79236183 CTGGCCCAGGCTGCAGGACCAGG - Intronic
1071332172 10:84571296-84571318 CTGGCTGGCGCTACCGGCCCGGG + Intergenic
1071443402 10:85724399-85724421 GTGGCAGAAGCTGACGGCCTGGG + Exonic
1073121113 10:101123084-101123106 CTGGCAGGGGCTGACAGCTCTGG + Intronic
1073142968 10:101261202-101261224 CGGCCAGAGGCTGCTGGCCTGGG + Intergenic
1073491483 10:103855718-103855740 CTGGCGGAGGCTGTGGGCGCAGG + Intergenic
1074678513 10:115880150-115880172 CTGGCAGTGGCTGTCAGCCAAGG + Intronic
1075031183 10:119025689-119025711 CTGGCACAGGCTGAGGGCTCTGG - Intergenic
1075374322 10:121965782-121965804 AAGGCAGAGGCTCCCAGCCCAGG + Intronic
1075443564 10:122498392-122498414 CTGGCAGATCCTTCCTGCCCTGG + Intronic
1075444611 10:122504739-122504761 CTGGCAGGGGCTGCTGGCCCAGG + Intronic
1076252628 10:128996104-128996126 CTGGAAGAGGCTGGGGTCCCTGG - Intergenic
1076265074 10:129103382-129103404 CTGGCACAGGCTGGCATCCCAGG - Intergenic
1076333206 10:129686849-129686871 CTGGCAACAGCTGCAGGCCCAGG - Intronic
1076340968 10:129744592-129744614 CTGGCAAAGGCTGCCTGCAGAGG + Intronic
1076436626 10:130450490-130450512 CTGGCAAAGGCTTCTGACCCTGG + Intergenic
1076562079 10:131373603-131373625 CAGGCAGAGGCTGCTGGAGCTGG - Intergenic
1076647402 10:131962695-131962717 CTGGCAGGGGCTGCCTGCACTGG + Intergenic
1076738091 10:132467647-132467669 CGGGCCGAGGCTGCCCTCCCAGG + Intergenic
1076776236 10:132699655-132699677 CTGGCTGACCCTGCGGGCCCTGG - Intronic
1076877619 10:133224246-133224268 CTGTCCCAGGCTTCCGGCCCTGG + Intronic
1076887486 10:133269359-133269381 CAGGCAGAAGCCGCGGGCCCGGG - Intronic
1077119396 11:899843-899865 CTGGCTGATGCTGCCTTCCCTGG + Intronic
1077225022 11:1435898-1435920 CGGGCAGGGGCCTCCGGCCCTGG + Intronic
1077336434 11:2007002-2007024 CTGGCTCAGCCTGCTGGCCCTGG + Intergenic
1077377211 11:2210687-2210709 CCAGCCGAGGCTGCTGGCCCTGG + Intergenic
1077378607 11:2217423-2217445 CTGTCTGAGCCTGCCGGCCTGGG - Intergenic
1077910343 11:6567384-6567406 CTGGGAGAGGCTGCTAGTCCAGG - Exonic
1079120819 11:17683651-17683673 CTGGCAGTTGCTGCTGGCACAGG - Intergenic
1079710984 11:23681065-23681087 AGGGCAGAGGCTGCAGGCCTAGG + Intergenic
1079730583 11:23935012-23935034 TTGGCAGGCCCTGCCGGCCCTGG - Intergenic
1080591184 11:33724215-33724237 CTGGCAGGAGCTGCCGGTTCAGG + Intronic
1081329723 11:41788489-41788511 CTGGCCGGCCCTGCCGGCCCTGG - Intergenic
1082020922 11:47532460-47532482 GAGGCAGACGCTGCCTGCCCAGG + Intronic
1082287522 11:50333699-50333721 CTGGCAGAGGCTCCAAGGCCTGG - Intergenic
1083670819 11:64299214-64299236 CTGGCTGAGGCTGGAGGACCAGG + Intronic
1083856615 11:65396240-65396262 AGTGCAGAGGCTGCCGGCTCAGG + Intronic
1084066050 11:66705023-66705045 CTGGTAGAGGCTGGCGGCTTGGG + Exonic
1084192203 11:67504373-67504395 CTCGCTGCGGCTCCCGGCCCCGG - Intronic
1085444063 11:76589135-76589157 CTGGCAGTGGCTGCAGGGCAGGG + Intergenic
1088570865 11:111222076-111222098 CCGGCAGGCCCTGCCGGCCCCGG + Intergenic
1088596884 11:111447820-111447842 GTGGCAGAGGCTGCCCTTCCTGG + Intronic
1089459763 11:118645663-118645685 CTGAGGGAGGCTGCGGGCCCAGG - Intronic
1089494787 11:118902583-118902605 CTGGGGGAGGCAGCCGCCCCTGG - Exonic
1089635314 11:119808062-119808084 CTGCCACAGGCTGGTGGCCCAGG - Intergenic
1089643838 11:119865049-119865071 CTGTCACAAGCTGCCGGCCGGGG - Intergenic
1089654248 11:119935486-119935508 CAGGCAGAGGTTGCAGACCCTGG - Intergenic
1090347438 11:126082779-126082801 CCGGCTGGGGCTGCCTGCCCTGG - Intergenic
1090359807 11:126164401-126164423 CTAGGAGAGGCTGTTGGCCCTGG - Intergenic
1090501735 11:127267528-127267550 CTGGCAGTGGCTGGAGGGCCAGG + Intergenic
1090903438 11:131052839-131052861 CTGGTAGAGGTGGCCGGACCAGG - Intergenic
1202819418 11_KI270721v1_random:62184-62206 CTGGCTCAGCCTGCTGGCCCTGG + Intergenic
1091555025 12:1566613-1566635 CGGGCAGAGGCTGCTGCCCAGGG - Exonic
1091650342 12:2304589-2304611 GAGGCAGGGGCTGCCTGCCCTGG - Intronic
1092148176 12:6229148-6229170 CTGGGAAAGGCTGCTGGCCTAGG - Intronic
1092572434 12:9739839-9739861 CCGGCAGGCCCTGCCGGCCCGGG - Intergenic
1094758526 12:33500135-33500157 CAGGCAGATGCTGCCAGGCCCGG + Intergenic
1095707611 12:45254385-45254407 CTGGCAGATACTGCCTCCCCAGG - Intronic
1096595513 12:52692554-52692576 GTGGCAGAAGCTGCAGGACCTGG - Exonic
1096847741 12:54417421-54417443 CTGGCAGAGGCTCCAGGCCAGGG + Intronic
1101930069 12:109006591-109006613 AAGGCAGAGGCTGCCGGCTTAGG + Intronic
1102039774 12:109793491-109793513 CACCCAGAAGCTGCCGGCCCAGG + Intronic
1103852720 12:123943678-123943700 GAAGCAGAGGCTGCCGTCCCTGG - Intronic
1103918603 12:124388327-124388349 CAGGCAGAGGCTGCCAGGCACGG + Intronic
1104183030 12:126400527-126400549 CAGGCAGTGGGTGCCGGCTCTGG - Intergenic
1104477381 12:129081910-129081932 GTGGCTGAGGCGGCCGGCCCTGG - Exonic
1104797259 12:131528370-131528392 CTGACTGAGGCTGTGGGCCCTGG - Intergenic
1104881144 12:132071417-132071439 CTACCAGAGGCTTCCGGCTCAGG + Intronic
1104887485 12:132119160-132119182 CAGGCAGAGGCTGGCGGGCCTGG - Intronic
1105821844 13:24087178-24087200 CTCCCAGAGCCTGCCAGCCCAGG + Intronic
1108359963 13:49659955-49659977 CCTGCAGAGGCTGCAGGCCCTGG - Intergenic
1111441892 13:88291917-88291939 CTGGCCGGCCCTGCCGGCCCCGG + Intergenic
1112037271 13:95508270-95508292 CAGGAAGAGGCTGCTGGACCTGG - Intronic
1112077768 13:95931703-95931725 CCGGCGGGCGCTGCCGGCCCGGG - Intronic
1113073120 13:106441010-106441032 CTGGCAGAGGATGGGGACCCAGG + Intergenic
1113560209 13:111272701-111272723 CTGGCATCGGCTGCCAGCGCTGG + Intronic
1113736201 13:112680441-112680463 ATGGCAGTGGCTCCCGGCCTGGG - Intronic
1115268644 14:31527345-31527367 CTGCCGGAGGCTGGCGGCGCCGG + Intronic
1115397038 14:32920028-32920050 CTGGCAGAAGTGGCTGGCCCTGG - Intergenic
1116390514 14:44384840-44384862 CTGGCAGGCCCTGCCGGCCCTGG + Intergenic
1117166794 14:53042697-53042719 CTGGCAGAGGCTTGAGGCACAGG + Intronic
1117837262 14:59819831-59819853 CTGGCTGGCGCTACCGGCCCAGG - Intronic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1118860054 14:69656000-69656022 CTGGCAGAGGCTGGAGGCAGGGG - Intronic
1121451472 14:94010999-94011021 GTGGCAGATGCTGCTGGTCCTGG + Intergenic
1121616874 14:95319522-95319544 CTGGCCGCGGCTGGCCGCCCTGG + Intronic
1122051411 14:99063202-99063224 CTGACAGAGGCTGCCTGACAGGG - Intergenic
1122069767 14:99198096-99198118 TTGGCAGAGGCTGCCGATGCAGG + Intronic
1122352328 14:101103351-101103373 GGGGCCGAGGCTGCAGGCCCAGG + Intergenic
1122372970 14:101239197-101239219 CTGCCAGGCGCTGCTGGCCCAGG + Intergenic
1122632419 14:103113039-103113061 CTGGCCAAGGCTGCGGGCCAGGG - Intergenic
1122652382 14:103232683-103232705 CTGGCACAGGCAGGGGGCCCTGG - Intergenic
1122771515 14:104099898-104099920 CTGGGTGGGGCTGCCTGCCCAGG + Intronic
1122863014 14:104591066-104591088 TGGGCAGGGGCTGGCGGCCCTGG - Intronic
1123687787 15:22811784-22811806 CTGGCATAGGCAGCTGGCCACGG - Intronic
1123783072 15:23645843-23645865 CTGGCAGCCCCTGCCTGCCCAGG - Exonic
1124237703 15:28004205-28004227 ACAGCAGAAGCTGCCGGCCCTGG + Intronic
1124251992 15:28113040-28113062 CTGGCTGGGCTTGCCGGCCCTGG - Intronic
1125603047 15:40925970-40925992 CTGGCAGAGCCTGGCAGCCGTGG - Intergenic
1125727574 15:41875863-41875885 CTGGTAGAGGTGGCCGGCTCTGG + Intronic
1127391897 15:58512539-58512561 CTCGCAGACCCAGCCGGCCCAGG - Intronic
1128260884 15:66232120-66232142 CTGGCCTAGGCTGCCTGCCGAGG - Intronic
1128341598 15:66826100-66826122 CTGGCACAGGCTGCCCACCCTGG - Intergenic
1128555641 15:68629960-68629982 CTGCCAGAGGCACCCTGCCCTGG + Intronic
1129726963 15:77906299-77906321 CTGGCAGAGCCTGCCCCCCAGGG + Intergenic
1129876946 15:78981870-78981892 CTGGCAAAGGCTGGATGCCCTGG + Intronic
1130162322 15:81414003-81414025 CCAGCAGAGGCAGCCGGCTCCGG - Intergenic
1130275312 15:82473104-82473126 CTGGCAGAGCCTGCCCCCCAGGG + Intergenic
1130467672 15:84200499-84200521 CTGGCAGAGCCTGCCCCCCAGGG + Intergenic
1130496593 15:84473043-84473065 CTGGCAGAGCCTGCCCCCCAGGG - Intergenic
1130589964 15:85205097-85205119 CTGGCAGAGCCTGCCCCCCAGGG + Intergenic
1131254815 15:90855117-90855139 CTGAGAGAGGCAGCCGGGCCTGG - Intergenic
1131962955 15:97808463-97808485 CTGGCAGAGGCTAAGGGTCCGGG - Intergenic
1132498172 16:273630-273652 CTGGGTGTGGCTGCCTGCCCAGG - Intronic
1132613911 16:831105-831127 CTGCCAGAGGCTGGGGCCCCAGG + Intergenic
1132661394 16:1063049-1063071 ATGGCAGAGGCTGGCGGGGCAGG - Intergenic
1132718533 16:1304323-1304345 CAGCCAGAGGCTGAGGGCCCAGG + Intergenic
1132836837 16:1958462-1958484 CTGGCCGGCCCTGCCGGCCCTGG - Intergenic
1133008822 16:2898919-2898941 CAGGCAGAGGCTTCTGGCCCTGG + Intronic
1133040576 16:3058251-3058273 CTGGGAGGGGCTGCCCGCCCAGG + Exonic
1134502725 16:14781730-14781752 ATGGCAGATGCTGCTGGCCTGGG - Intronic
1134577838 16:15347165-15347187 ATGGCAGATGCTGCTGGCCTGGG + Intergenic
1134677721 16:16102343-16102365 CTGGCACAGGATGCTGGCTCAGG + Intronic
1134724750 16:16410381-16410403 ATGGCAGATGCTGCTGGCCTGGG - Intergenic
1134942682 16:18301478-18301500 ATGGCAGATGCTGCTGGCCTGGG + Intergenic
1135309689 16:21395824-21395846 CAGGCAGAGCCTGCAGTCCCAGG + Intergenic
1135404780 16:22190351-22190373 CGTGCAGAGGCTGCAGGCCTAGG - Exonic
1136149267 16:28336137-28336159 CAGGCAGAGCCTGCAGTCCCAGG + Intergenic
1136162022 16:28426303-28426325 CTGGCCGAGGCTGGTGGCCAGGG + Intergenic
1136200944 16:28688687-28688709 CTGGCCGAGGCTGGTGGCCAGGG - Intronic
1136217284 16:28802871-28802893 CTGGCCGAGGCTGGTGGCCAGGG - Intergenic
1136306433 16:29374948-29374970 CAGGCAGAGCCTGCAGTCCCAGG + Intergenic
1137432113 16:48426939-48426961 CTGGGGGAGGCTGCCAGCCCTGG + Intronic
1137714802 16:50592148-50592170 CTGGAATAGGCAGCCGGCTCAGG + Intronic
1138098536 16:54232761-54232783 ATGGCAGAGGCTGCCTGACTAGG + Intergenic
1138248711 16:55485864-55485886 CTGGCAGTGGCAGCCAGTCCTGG - Intronic
1138598349 16:58041317-58041339 CCAGCAGAGGCTCCAGGCCCTGG - Intronic
1139937388 16:70581303-70581325 CGGACAGAGGCTGCCCGTCCAGG - Intronic
1141554537 16:84828190-84828212 CTGGCCCGGGCTGCCAGCCCTGG + Intronic
1141952643 16:87348622-87348644 AGGGCAGAGGCAGCCGGCCCAGG + Intronic
1142077551 16:88128822-88128844 CTGTCAGATCCTCCCGGCCCAGG - Intergenic
1142111438 16:88333674-88333696 GTGGCCGGGGCTGCCTGCCCAGG + Intergenic
1142438979 16:90082207-90082229 CTGGGAGAGGCTGCGGCCTCGGG + Intronic
1142583993 17:959360-959382 CGCGCAGAGGCTGCCTGCCCCGG + Intronic
1142610041 17:1104097-1104119 GTGGCAGAGGCTGTGGGACCTGG - Intronic
1142860069 17:2755866-2755888 CGGGCTGAGGCTGCGGGGCCCGG + Intergenic
1142959470 17:3543437-3543459 CTGGCAGAGGGTGCAGGGCTGGG - Intronic
1143020398 17:3914583-3914605 CTGGGAGAGGCTGTCTGCGCAGG - Intronic
1143425238 17:6831176-6831198 CTGGCAGAGGCTGTCGGCAGTGG + Intronic
1143503524 17:7351991-7352013 CTGGCAGACGCTGGCGGGACGGG - Intronic
1143539186 17:7559276-7559298 CTGGCAGAGTCTCCCGGAGCAGG + Exonic
1144514983 17:15911102-15911124 CTCCCACAGGCTGCCTGCCCTGG - Intergenic
1144637983 17:16923166-16923188 CTGGGAAATGGTGCCGGCCCAGG + Intergenic
1144717964 17:17447313-17447335 AGGGCAGGGGCTGCCGGCCCCGG + Intergenic
1145234583 17:21199747-21199769 CTGGGGGCTGCTGCCGGCCCAGG - Intronic
1145248544 17:21285072-21285094 CTGGCAGCGGCGTCCGGTCCCGG + Intronic
1145782457 17:27571996-27572018 CTGGCAGAGGCTGGCGTCACAGG - Intronic
1146891120 17:36507059-36507081 CAGGCAGGGGCTGCCTGCCAGGG + Exonic
1147142326 17:38466612-38466634 CTGGGAGGCGCTGCGGGCCCGGG - Exonic
1148664094 17:49361908-49361930 GAGGCGGAGGCGGCCGGCCCGGG - Intronic
1148845024 17:50524840-50524862 GTGGCAGAGGATGGCAGCCCAGG - Intronic
1148870823 17:50658018-50658040 AGGGCAGGGGCTGCAGGCCCAGG + Intronic
1149300943 17:55304287-55304309 TGGGGAGAGGCTCCCGGCCCAGG + Intronic
1149540123 17:57462367-57462389 CTGGCAGGGGCTGGCAGCCCAGG - Intronic
1149601052 17:57893180-57893202 ATGGCAGAGGCTGCTGGGCTGGG + Intronic
1150284956 17:63949336-63949358 CTTGCAGGGGCTGCAGGCCTGGG + Intronic
1150533809 17:66014265-66014287 CTGGCACAGTCTGCCAGCACAGG + Intronic
1150788253 17:68179946-68179968 CTGGCCGGCCCTGCCGGCCCCGG + Intergenic
1151353739 17:73546372-73546394 GTGGCAGAAGCTGCTGGCCCAGG - Intronic
1151675748 17:75596528-75596550 CAGCCAGATGCTGCTGGCCCAGG + Intergenic
1151679486 17:75615972-75615994 AGGGAAGAGGCTGCTGGCCCAGG + Intergenic
1152177515 17:78797560-78797582 CTGGCAGAGGCTGCTGCCCCTGG - Exonic
1152270260 17:79320335-79320357 CTGGCAGAGGCTGCCAGCACTGG - Intronic
1152642164 17:81453838-81453860 GTGGCAGAGGCAGTTGGCCCCGG + Intronic
1152809385 17:82374358-82374380 CTGCCAGTGGCGGCCAGCCCAGG - Exonic
1154378890 18:13832042-13832064 TTGGCAAAGGCTCCCGTCCCGGG - Intergenic
1156448705 18:37254366-37254388 CGGGCACAGGGTGCCGGCCTGGG + Intronic
1156461930 18:37326104-37326126 CTGGGAGAGGAGGCCGGGCCAGG + Intronic
1157512810 18:48290683-48290705 CAGGAAGAGGATGCAGGCCCAGG - Intronic
1158956606 18:62546269-62546291 CTGGCAGATGGAGCCTGCCCCGG - Intronic
1159346746 18:67215887-67215909 CTAGCAGAGGGAGCCGGCTCCGG + Intergenic
1160342909 18:78104610-78104632 CAGGCTCACGCTGCCGGCCCTGG - Intergenic
1161007520 19:1943946-1943968 CTGGCAGGGGCTGCGGGCCTCGG + Intronic
1161253887 19:3295636-3295658 CTGGCAGAGCCCAACGGCCCTGG - Intronic
1162017562 19:7853672-7853694 TGGGCAGAGGCTCCGGGCCCAGG + Intronic
1162506560 19:11089531-11089553 CTGGCAGAGGCTGCGAGCATGGG + Exonic
1162959483 19:14117597-14117619 CTGGCTGCGGCCGGCGGCCCCGG + Exonic
1162987091 19:14277723-14277745 CAGGCTGGCGCTGCCGGCCCTGG + Intergenic
1163605894 19:18275082-18275104 CAGGCAGAGGCTTCTGGGCCAGG - Intergenic
1163779928 19:19240690-19240712 GTGGCAGGGGCTGCGGGCCTAGG + Intronic
1164748062 19:30630565-30630587 CTGGCAGGGTCTGCGGGCCAGGG - Intronic
1164756250 19:30691934-30691956 CGGGCAGAGGCTGCAGGCAGGGG - Intronic
1165091996 19:33392505-33392527 CTGGCAGAGGCCGGGGCCCCAGG + Intronic
1165383598 19:35497456-35497478 CTGGCACAGGCTGGGGGCCAAGG + Exonic
1165436181 19:35796819-35796841 CTGGCTGTGGCTGGGGGCCCAGG - Intergenic
1165879507 19:39032296-39032318 CAGGCAGAGGCTGCGCGCCGCGG - Intronic
1166036236 19:40170403-40170425 CCGGCAGGCCCTGCCGGCCCCGG - Intergenic
1166122515 19:40694017-40694039 GTGGCAAAGGCTGCAGGCCTGGG + Intronic
1166704496 19:44901132-44901154 CTGCCAGGGGCTGCTGGGCCTGG + Intronic
1167604944 19:50476621-50476643 GGGGCAGCGGCTGCCGGGCCGGG + Exonic
1168475992 19:56675638-56675660 CTGGAAGGAGCTGCCTGCCCTGG - Intergenic
1168673473 19:58258902-58258924 GTGGCAGAGGCTCCCAGCTCAGG - Intronic
1168701458 19:58442031-58442053 CTGGGAGGTGCTGCTGGCCCTGG + Intergenic
925723536 2:6851508-6851530 GTTGCAGAGGCTGCAGGGCCGGG - Exonic
926116561 2:10217411-10217433 CGGGAAGAGGCTGCCGCACCGGG - Intergenic
926718609 2:15942674-15942696 CTGGCCGGGGCTGCGGGCACGGG - Exonic
927488212 2:23503731-23503753 CTGGCAGCTGCTGCCGGTCAGGG - Intronic
928085516 2:28344144-28344166 GTTGCAGAGGCGGCTGGCCCGGG - Intergenic
928964835 2:36966363-36966385 CTGGCGGAGGCTGCCGCGGCCGG - Exonic
930004108 2:46882445-46882467 CAGCCAGAGGCAGCCTGCCCTGG + Intergenic
930039197 2:47107378-47107400 CTGGCCGGCCCTGCCGGCCCCGG + Intronic
930695876 2:54411301-54411323 CAGGTAGAGGCTGCTGGCCCAGG + Intergenic
930720286 2:54631467-54631489 GCGGCAGCGGCTGCAGGCCCTGG + Exonic
931643897 2:64404479-64404501 CCGGCACAGGCTGCAGGCCAAGG + Intergenic
931657684 2:64524696-64524718 CGGGCAGATGCTCCCGGCCCGGG - Intronic
932739821 2:74282920-74282942 CGGGCAGTGGCTTCAGGCCCTGG + Intronic
935011673 2:99141659-99141681 CTGCCTGAGGCTGCCGCACCTGG + Exonic
935529758 2:104218044-104218066 CTGGCAGTGGCTGCAGGCTGTGG - Intergenic
935676366 2:105598022-105598044 CTGGCTGTGGCTGAAGGCCCTGG - Intergenic
935692652 2:105744982-105745004 CGGGCGGACCCTGCCGGCCCGGG - Exonic
935692659 2:105745001-105745023 CGGGCGGACGCTGCCGGCCCGGG - Exonic
936089511 2:109491867-109491889 AGGGCAGAGGCTGCCTTCCCGGG - Intronic
936581538 2:113704667-113704689 CCGGCAGGCCCTGCCGGCCCCGG - Intergenic
937310521 2:120900022-120900044 CATGCAGAGGCTGCCGGCCGGGG + Intronic
937973394 2:127566585-127566607 CTGGCAGAGGTACTCGGCCCTGG - Intronic
938116640 2:128606944-128606966 GTGGCAGGGGCTGCCAGACCTGG + Intergenic
938187109 2:129241182-129241204 CTTGCAGAGGCAGCAGGCACAGG - Intergenic
939281738 2:140073887-140073909 CCGGCAGGCCCTGCCGGCCCCGG + Intergenic
940293335 2:152098694-152098716 CTGGGGGAGGCTGCGGGCTCCGG + Intronic
941688251 2:168469950-168469972 CTGGCAGAGCCTGGCTGACCTGG + Intronic
942241348 2:173965589-173965611 CTGGCAGCGGCAGCCGGCGAGGG - Exonic
943941454 2:194003000-194003022 CTGGCTGGCGCTGCCAGCCCTGG - Intergenic
944669770 2:201985094-201985116 CCGACAGAAGATGCCGGCCCTGG - Intergenic
945251767 2:207770161-207770183 CTGGCAAGGGCTTCCCGCCCGGG - Intergenic
946174293 2:217913126-217913148 CTGGCAGAGGATGCTGGCAGTGG + Intronic
946410486 2:219513009-219513031 CAGGCAGAGGCTGCGGGGCCAGG + Intergenic
947398975 2:229714088-229714110 CGGGAAGAGGCTGCTGGTCCCGG + Intronic
947535127 2:230935286-230935308 CTGGGAGTGGCTGCCGGGCTGGG - Intronic
947660188 2:231860727-231860749 CAGGCACAGGCTGCCGTCACTGG + Intergenic
947918644 2:233850902-233850924 CTGGGGGAGGCTGTGGGCCCTGG - Intronic
948197634 2:236107206-236107228 CTGGGAGAGGGTGGCTGCCCAGG + Intronic
948666639 2:239538840-239538862 CAGGGAGAGGCTGCGGGGCCTGG - Intergenic
948764473 2:240212419-240212441 CTGGCTGAGGCTCCAGGCCCTGG - Intergenic
1170892624 20:20389034-20389056 CTGGCAGAGGCCACCTGGCCAGG + Intergenic
1171186394 20:23126939-23126961 CTGGCAGACGCTGGGGGTCCAGG + Intergenic
1172115647 20:32571996-32572018 CTGGCAGAGGGTGCCAACCTTGG - Intronic
1172646634 20:36474392-36474414 CTGGCAGATTCTGACAGCCCTGG - Intronic
1172704381 20:36872362-36872384 GGGGCCGAGCCTGCCGGCCCTGG + Intergenic
1173582932 20:44160121-44160143 CTGGAAGAGGCCGCCGCCCTTGG + Exonic
1174044799 20:47725914-47725936 CTGGCACAACCTGCTGGCCCCGG + Intronic
1175787868 20:61723434-61723456 CCGGAGGAGGCTGCAGGCCCTGG - Intronic
1176369143 21:6052107-6052129 CTGGCAGAGTCAGCTGGCCCCGG - Intergenic
1178366201 21:31990974-31990996 CTGGCAGAGCCTGCTGCCCTGGG - Intronic
1178847202 21:36183695-36183717 CTGGCAGAGGCGGCAGGTGCTGG - Intronic
1179584559 21:42366352-42366374 CTGGCGGAGGCTGCCAGAGCTGG + Intronic
1179635105 21:42703707-42703729 CCGGCAAAGGCTGCTGGCCTTGG + Intronic
1179754376 21:43486434-43486456 CTGGCAGAGTCAGCTGGCCCCGG + Intergenic
1179801195 21:43812223-43812245 CTGGGAAAGGCTGCGGGGCCAGG - Intergenic
1179814173 21:43893247-43893269 CTAGCAGAGGCTGCTGGCTCAGG - Intronic
1180199175 21:46214606-46214628 CTGACAGAGTCAGCAGGCCCTGG - Intronic
1180835376 22:18927028-18927050 CTGGCGGGGGCTCCTGGCCCAGG - Intronic
1180846057 22:18983128-18983150 CTGGCAGGGGCTGCCAGGCTGGG - Intergenic
1180951931 22:19724365-19724387 CCTGCGGAGGCTGCGGGCCCGGG + Exonic
1181580827 22:23827238-23827260 CTGGCAGCGGCTGCAGGACTAGG - Intronic
1181711965 22:24696641-24696663 CTGGCAGGGGCTCCTGGCCCAGG - Intergenic
1182222878 22:28772778-28772800 GTGGCTGCGGCTGCCGGGCCTGG + Exonic
1182277662 22:29200706-29200728 CTGGCAGAGGGGGCAGGACCGGG - Intergenic
1182485160 22:30635057-30635079 CGGACAGAGGCTGCTGGCCGGGG + Intergenic
1182547603 22:31085019-31085041 CGGGCAGTCGCTTCCGGCCCCGG + Intronic
1182618482 22:31604705-31604727 CTGGGAGGGTCTGCTGGCCCTGG + Intronic
1183063685 22:35349915-35349937 CTGTCTGAGGCTGCAGGCCTGGG + Intergenic
1183213542 22:36465366-36465388 CGGGCAGAGGCTGCCAACCTGGG + Intergenic
1183363361 22:37394451-37394473 CTGGAACAGGCGGCCGGGCCAGG - Intronic
1183627815 22:39015387-39015409 CTGGCAGGGGCAGCAGGGCCGGG - Intronic
1183642051 22:39098689-39098711 CTGGCAGGGGCAGCAGGGCCGGG - Intronic
1183697368 22:39430883-39430905 CTGCCAGAGGATGGCGGCCTGGG + Exonic
1183742914 22:39678451-39678473 CCGGCAGAGGCTCCCTGGCCTGG + Intronic
1183858427 22:40652321-40652343 TTGGAAAAGGCTGCCAGCCCAGG + Intergenic
1184727039 22:46353227-46353249 CTGAAGAAGGCTGCCGGCCCAGG + Intronic
1184737843 22:46409638-46409660 CCACCAGAGGCTGCCGGACCTGG + Intronic
1185088128 22:48751731-48751753 CTGGCAGAGGCTGCCGGCCCGGG - Intronic
1185286299 22:50001317-50001339 CTGGCAAAGACTGCAGCCCCAGG - Intronic
1185301519 22:50083621-50083643 CAGGCAGGGGCTCCAGGCCCAGG + Intronic
1203285464 22_KI270734v1_random:152327-152349 CTGGCGGGGGCTCCTGGCCCAGG - Intergenic
949980536 3:9499676-9499698 CTTTCAGAGGCTGGAGGCCCGGG - Exonic
949987529 3:9552713-9552735 CTGGCGGGGGCCGCCGGCCCGGG + Exonic
950294042 3:11812706-11812728 CTGGCAGAAGCAATCGGCCCTGG + Intronic
950530030 3:13548123-13548145 CAGGCACAGGCTGCCAGCTCAGG + Intergenic
950690425 3:14651810-14651832 GTGGCAGAGGGTCCCGGTCCAGG - Exonic
951804574 3:26630334-26630356 CTGACAAAGCCTGCGGGCCCTGG + Intronic
952058104 3:29473764-29473786 CTGGCCGGCCCTGCCGGCCCCGG - Intronic
952890812 3:38039317-38039339 CTGGCTGGGGCTGCTGGACCCGG - Exonic
953121185 3:40044241-40044263 CTGGCAGACGCAGCAGACCCAGG - Exonic
954432389 3:50477815-50477837 CTGGAGGAGGCAGCAGGCCCAGG - Intronic
957074074 3:75587896-75587918 CTGGCCGGCCCTGCCGGCCCCGG + Intergenic
961403540 3:126663679-126663701 CTGGCAGGGACTGCAGACCCAGG - Intergenic
961943062 3:130657009-130657031 CTGGCTGCGGCTGTGGGCCCAGG - Intronic
962350661 3:134653389-134653411 CTGGGAGATGCTGCTGCCCCTGG + Intronic
963533251 3:146497396-146497418 CTGGCCGGCCCTGCCGGCCCCGG + Intergenic
963920473 3:150900132-150900154 CTGGCCAAGGCTGCTGGCTCAGG - Intronic
964974156 3:162599796-162599818 CTGGCCGGCCCTGCCGGCCCCGG + Intergenic
965040282 3:163499121-163499143 CCGGCAGGCCCTGCCGGCCCCGG + Intergenic
965615023 3:170585212-170585234 CTTGCTGGGGCTGCCGGCTCTGG + Intronic
968506313 4:972904-972926 CTGGGAGAGGAAGCCGGCCATGG + Intronic
968617140 4:1582504-1582526 CAGGAGGAGGCTGGCGGCCCTGG + Intergenic
968671798 4:1856059-1856081 CTGACAGAGGCGGCTGGCCTCGG + Exonic
968741034 4:2331872-2331894 CTGGCAGAGGAGGCCTGCCTGGG - Intronic
971287900 4:25307990-25308012 AAGGCAGAGGCTGCCGGGGCAGG + Intergenic
972725817 4:41745943-41745965 CTGGCTGCGGCTGGGGGCCCTGG - Exonic
973960754 4:56107560-56107582 CTGCCAGTGGTGGCCGGCCCTGG - Intergenic
974074631 4:57157347-57157369 CTGTCAGAGGCTGCCTGCTCTGG + Intergenic
975281475 4:72568070-72568092 TGGGCAGAGGCTGCAGGCGCCGG - Intronic
977177453 4:93834618-93834640 CTGGCAGAGGCTCCTGGCCGCGG + Intergenic
979674570 4:123397880-123397902 CAGGCAGAGGCTGCCGCGGCCGG - Intronic
980328407 4:131379317-131379339 CTGGCAGAGGCCGCAGCCACCGG + Intergenic
982985750 4:162203686-162203708 CCGGCCGGCGCTGCCGGCCCTGG + Intergenic
983425689 4:167581658-167581680 CTGGCTGCCACTGCCGGCCCCGG + Intergenic
983428699 4:167620186-167620208 CTGTCAGAGGGAGCAGGCCCAGG + Intergenic
984444808 4:179823637-179823659 CTGGCAGATGCTGGAGACCCAGG - Intergenic
985269286 4:188179060-188179082 CTGGCAGGCGCCGCCCGCCCCGG + Intergenic
985366386 4:189236406-189236428 CTGGCGGCCCCTGCCGGCCCCGG + Intergenic
985548302 5:520832-520854 CTTGCAGAGACTGCCAGGCCTGG - Intronic
985607225 5:864475-864497 TTGGCAGAGGCCGCAGGCTCTGG + Exonic
986014852 5:3748830-3748852 CAGGCAGAGGATGCAGGCTCTGG - Intergenic
987156803 5:15096817-15096839 CCGGCCGACCCTGCCGGCCCCGG - Intergenic
987355802 5:17062180-17062202 CTAGCCGAGGGTGCCGGCTCCGG - Intergenic
987532797 5:19143032-19143054 CCGGCCGACCCTGCCGGCCCCGG - Intergenic
991276527 5:64853974-64853996 CTGTCAGAGGCTGAGGGCACAGG - Intronic
991491010 5:67182550-67182572 TGGGCAGGGACTGCCGGCCCCGG - Exonic
992050350 5:72935337-72935359 CTGGCTGGCGCTGCCGGCCCCGG + Intergenic
994509854 5:100689129-100689151 CTGGCTGGCCCTGCCGGCCCCGG - Intergenic
994853905 5:105091605-105091627 CTTCCAGGGGCTGCTGGCCCTGG - Intergenic
996530382 5:124521720-124521742 CCGGCCGCCGCTGCCGGCCCTGG + Intergenic
997158208 5:131580295-131580317 CCGGCTGGTGCTGCCGGCCCTGG - Intronic
997485218 5:134225658-134225680 ATGGCGGAGGCCGCCGGTCCGGG - Intronic
997998477 5:138605424-138605446 CAGGCAGCAGCTGCCGTCCCCGG + Intergenic
998093061 5:139382144-139382166 CTGGAACCGGCTGCCTGCCCAGG + Intronic
999188510 5:149730427-149730449 CCGGCTGGGGCTGCGGGCCCGGG + Intronic
999381284 5:151123293-151123315 CTGGCAATGGCTGCCCACCCTGG + Intronic
1000098561 5:157992813-157992835 CAGGCAGAGGCTGTCGCACCTGG + Intergenic
1001630871 5:173174424-173174446 CTGGCACACGCTGCCAGGCCTGG - Intergenic
1001864444 5:175091296-175091318 CTGGCAGAGGCAGCGGACTCAGG + Intergenic
1002351665 5:178588283-178588305 CCAGCAGTGGCTGCCTGCCCAGG + Intronic
1002385108 5:178860424-178860446 AGGGCAGAGGCAGCCGGGCCCGG + Intronic
1002898223 6:1391170-1391192 GTGGCAGTGGCCGCCAGCCCTGG - Intronic
1004694380 6:18020121-18020143 CTGGCCGGCTCTGCCGGCCCCGG + Intergenic
1005315471 6:24599179-24599201 CTGGTACAGGCTGTCAGCCCCGG - Intronic
1005758906 6:28950054-28950076 CCGGCAGGCCCTGCCGGCCCCGG - Intergenic
1005889737 6:30127321-30127343 CCGGCACTGGCTGCTGGCCCAGG + Intergenic
1006428476 6:33980652-33980674 GAGGCAGGGGCTGCAGGCCCCGG + Intergenic
1007095824 6:39212425-39212447 TTGGCAGAGCCTGCCTCCCCTGG + Intronic
1007168219 6:39843503-39843525 CTGGGAAAGGCTGCCTGCGCTGG + Intronic
1007223922 6:40299730-40299752 CTGGCATAGGCTGGAGGCACAGG - Intergenic
1007412629 6:41673824-41673846 CTGCAGGAGGCTGCCGGGCCAGG - Intergenic
1007416448 6:41694063-41694085 CTGGCAGTGCCAGCCGGCACAGG + Intronic
1009407112 6:63326715-63326737 CCGGCAGGCGCTGCTGGCCCTGG - Intergenic
1009971322 6:70628091-70628113 CTAGCAGAGGGAGCCGGCTCCGG + Intergenic
1011983522 6:93416844-93416866 CGGGCAAAGGCTGGCGTCCCGGG + Intronic
1013339428 6:109199052-109199074 CTGGGAGAGGCAGCCAACCCTGG + Intergenic
1014940136 6:127428552-127428574 CAGGTTGAGGCTGCTGGCCCCGG + Intergenic
1015812710 6:137177368-137177390 CTGGCAGAGGCTCCTGCCCAAGG + Intergenic
1016184739 6:141184007-141184029 CTGGCAGCGGCAACCTGCCCCGG + Intergenic
1018952529 6:168388649-168388671 CTGGCTGAGGCTGCAGCCTCAGG - Intergenic
1019155718 6:170037650-170037672 TGGGCAGAGGCTGCAGGTCCTGG - Intergenic
1019293149 7:260200-260222 CGGACAGAGGCGGCCGGCGCCGG + Exonic
1019336375 7:484889-484911 CTGGCGGAGGCTGTCGGCTTGGG - Intergenic
1019421892 7:954511-954533 CGGGCTGACGCTCCCGGCCCCGG - Intronic
1019487036 7:1294144-1294166 CTGGCAGACGCAGCCAGCCCTGG - Intergenic
1020007840 7:4791832-4791854 CTGGCAGCTGCTGCCAGTCCTGG + Intronic
1020017744 7:4841368-4841390 CTGGCAGTGGCTCCCCTCCCTGG - Intronic
1020073569 7:5243159-5243181 CTGGCAGAGGCTGAGGGAACAGG + Intergenic
1020796916 7:12687251-12687273 TTGGCAGTGACTGCGGGCCCCGG + Intronic
1022445139 7:30464259-30464281 CTGGCAGAGGCTGCTGGGCAAGG - Intronic
1022785796 7:33635429-33635451 CAGGGAGAGGCTGCCAGGCCTGG + Intergenic
1023852400 7:44157760-44157782 CTGGCAGCAGCTGCCCGACCTGG - Intronic
1023852735 7:44159249-44159271 CTGCCTGAGGCTGGCAGCCCAGG + Exonic
1023940886 7:44767815-44767837 GTGGCAAGGGCTGCCGGCCTGGG - Exonic
1024000950 7:45189151-45189173 TGGCCAGAGGCTGCTGGCCCAGG + Intergenic
1024322633 7:48086111-48086133 CTGGCTGAGCCTGCAAGCCCTGG + Intergenic
1025078724 7:55964644-55964666 CTGCAGGAGGCCGCCGGCCCAGG - Exonic
1025962085 7:66231601-66231623 CTGGCTGGCCCTGCCGGCCCCGG - Intronic
1026869178 7:73840423-73840445 TGGGCAGAGGCTCCTGGCCCAGG + Exonic
1032075104 7:128832398-128832420 CCTGCTGAGGATGCCGGCCCAGG - Intronic
1032437107 7:131909426-131909448 CCGGCCGGCGCTGCCGGCCCCGG + Intergenic
1034575370 7:151992473-151992495 CTGGCCGTGGCTGCCAGTCCCGG + Intronic
1035361857 7:158318561-158318583 TCGGAAGAGGCCGCCGGCCCTGG - Intronic
1035404428 7:158588239-158588261 CGGGTAGAGGCCGCCTGCCCAGG - Intergenic
1035463914 7:159063401-159063423 CCGGCCGGCGCTGCCGGCCCCGG - Intronic
1035558956 8:590704-590726 CTGCCAGAGGCTGGGGGCCAGGG + Intergenic
1035725637 8:1823699-1823721 GCGGCAGAGGCTCCCGCCCCCGG - Intergenic
1035727385 8:1833492-1833514 GTGGCAGCGGCTGAAGGCCCCGG - Intronic
1035735055 8:1881698-1881720 CTGGCCGTGTCTGCCTGCCCTGG - Intronic
1035931316 8:3783401-3783423 CTGGCACAGTCAGGCGGCCCTGG + Intronic
1036914963 8:12796394-12796416 CTGGCCGGCCCTGCCGGCCCCGG + Intergenic
1037150055 8:15626180-15626202 GTGGCAGAGGCTCCAGGCCTGGG - Intronic
1037878646 8:22561906-22561928 CTGGAAGATGTTGCCGGGCCGGG - Exonic
1038038451 8:23705382-23705404 CTGGCAGAGGAGGCCTGCCCTGG + Intronic
1038643063 8:29342658-29342680 CTGGCACCGGCTGCTGGCCATGG + Intronic
1039289397 8:36077588-36077610 GTGGCAGAGGCAGCTGGCTCAGG - Intergenic
1039542221 8:38381957-38381979 ATGGCAGAGGCGTCCGGCGCGGG - Exonic
1039981867 8:42415141-42415163 CTGGCAGAGGCTCCCTGTCTTGG - Intergenic
1040466811 8:47702947-47702969 CTGGCCGAGGTTGCTGGCCAAGG - Intronic
1040952877 8:52953916-52953938 CTGCCAGGGGCTGTCGGCACTGG - Intergenic
1041389309 8:57334970-57334992 CTGGCAGGGGATGCTGCCCCTGG + Intergenic
1042166774 8:65953042-65953064 CTGTCAGAGGATGCCGGCCTTGG - Intergenic
1042169497 8:65978053-65978075 CTGGCAGACGCCACCAGCCCTGG - Intergenic
1044788668 8:95823737-95823759 CCGGCCGACCCTGCCGGCCCCGG + Intergenic
1044819283 8:96145014-96145036 TCGGCCGAGGCTGCGGGCCCGGG - Exonic
1046288889 8:112132790-112132812 CCGGCAGGCCCTGCCGGCCCCGG + Intergenic
1048897246 8:139003161-139003183 CTGACAGAGGCTGCAGGCTGTGG + Intergenic
1049191203 8:141288751-141288773 CTCACGGAGGGTGCCGGCCCTGG + Intronic
1049510099 8:143022934-143022956 CTGACAGAGGAAGCCGGCCCAGG + Intronic
1049536812 8:143186302-143186324 CTGGCAGAGGAGGCACGCCCGGG - Intergenic
1049690994 8:143958813-143958835 CTGGGTGAGGCAGCCGCCCCAGG - Intronic
1056660290 9:88538190-88538212 CAGGCAGAGGCTGCCAGCATGGG + Intronic
1056809729 9:89754884-89754906 CTAACAGAGGCTGAAGGCCCAGG + Intergenic
1056937160 9:90924713-90924735 TTGGCAGAGGCCACCGGCCCTGG - Intergenic
1057827171 9:98380209-98380231 CTCGCAGAGGCTGAGGGCACAGG + Intronic
1057922176 9:99105747-99105769 GTGCCAGAGGCTGCCGAACCCGG + Intronic
1059438562 9:114290220-114290242 CTGGCAGCCCCTGCAGGCCCTGG - Exonic
1060267672 9:122121779-122121801 CTTGCATAGGCTGCCTGTCCAGG + Intergenic
1060406873 9:123377168-123377190 GAGGCAGAGGCTGCCAGCCAAGG - Exonic
1060999859 9:127897016-127897038 CTGGCAGAGACTGTCGAGCCTGG - Intronic
1061111688 9:128576879-128576901 CTGGCAGCGGCTGAAGGGCCTGG + Exonic
1061479890 9:130892436-130892458 CCGGGAGTGGCTGCAGGCCCGGG - Intergenic
1062228189 9:135465685-135465707 CTGGCAGGGGCTCACGGCCCAGG + Intergenic
1062274267 9:135723406-135723428 ATGGCAGTGGATGCCGGCGCCGG - Intronic
1062396388 9:136354561-136354583 CGGGCAGGGGCTGCCAGCGCCGG + Intronic
1062590640 9:137272985-137273007 CCGGAAGAGGCTCCCGGACCTGG + Exonic
1062614842 9:137391599-137391621 CTGGCAGAGGCAGCAGCTCCAGG - Intronic
1062652917 9:137587479-137587501 CCTCCAGAGGCTGCCGGTCCTGG + Intronic
1186190668 X:7064689-7064711 CTGGGAGATGCTGGAGGCCCAGG - Intronic
1186355202 X:8783403-8783425 ATGGCCGAGGCTGCAGGCTCAGG - Intergenic
1188751403 X:33909985-33910007 CTGGTAAAGGCTGACGGCTCTGG - Intergenic
1189216776 X:39332025-39332047 TTAGCAGAGGCTGAAGGCCCAGG - Intergenic
1189293925 X:39905446-39905468 CTCTCTGATGCTGCCGGCCCGGG - Intergenic
1190357375 X:49618379-49618401 CTGGGAGAGGCTGAGGGGCCAGG - Intergenic
1192125678 X:68498933-68498955 CTGGCAATGGCCGGCGGCCCCGG - Exonic
1192729808 X:73791589-73791611 CTGGCAAAGGCAGCCGGGCGTGG - Intergenic
1196761992 X:119208735-119208757 CTGGCCGGCCCTGCCGGCCCCGG - Intergenic
1197031650 X:121823717-121823739 GTGGCTCAGGCTGCCGGTCCAGG - Intergenic
1200043079 X:153384075-153384097 CTGGCAGAGGCTGCCCACAGGGG + Intergenic
1200118382 X:153779124-153779146 CTGGCAGAGCCTGGGGGCACAGG + Exonic