ID: 1185094379

View in Genome Browser
Species Human (GRCh38)
Location 22:48798419-48798441
Sequence GCTCTGGGGCGCGCTGGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 149}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185094379_1185094381 -10 Left 1185094379 22:48798419-48798441 CCAAAGCCAGCGCGCCCCAGAGC 0: 1
1: 0
2: 1
3: 17
4: 149
Right 1185094381 22:48798432-48798454 GCCCCAGAGCTGCCTAACGTTGG 0: 1
1: 0
2: 1
3: 7
4: 93
1185094379_1185094389 11 Left 1185094379 22:48798419-48798441 CCAAAGCCAGCGCGCCCCAGAGC 0: 1
1: 0
2: 1
3: 17
4: 149
Right 1185094389 22:48798453-48798475 GGGGTTCATCCCATGAGGAGCGG 0: 1
1: 0
2: 1
3: 10
4: 153
1185094379_1185094390 12 Left 1185094379 22:48798419-48798441 CCAAAGCCAGCGCGCCCCAGAGC 0: 1
1: 0
2: 1
3: 17
4: 149
Right 1185094390 22:48798454-48798476 GGGTTCATCCCATGAGGAGCGGG 0: 1
1: 1
2: 1
3: 10
4: 158
1185094379_1185094383 -9 Left 1185094379 22:48798419-48798441 CCAAAGCCAGCGCGCCCCAGAGC 0: 1
1: 0
2: 1
3: 17
4: 149
Right 1185094383 22:48798433-48798455 CCCCAGAGCTGCCTAACGTTGGG No data
1185094379_1185094393 25 Left 1185094379 22:48798419-48798441 CCAAAGCCAGCGCGCCCCAGAGC 0: 1
1: 0
2: 1
3: 17
4: 149
Right 1185094393 22:48798467-48798489 GAGGAGCGGGTCTGATGCCCCGG 0: 1
1: 0
2: 2
3: 15
4: 139
1185094379_1185094394 26 Left 1185094379 22:48798419-48798441 CCAAAGCCAGCGCGCCCCAGAGC 0: 1
1: 0
2: 1
3: 17
4: 149
Right 1185094394 22:48798468-48798490 AGGAGCGGGTCTGATGCCCCGGG 0: 1
1: 0
2: 0
3: 13
4: 127
1185094379_1185094385 -8 Left 1185094379 22:48798419-48798441 CCAAAGCCAGCGCGCCCCAGAGC 0: 1
1: 0
2: 1
3: 17
4: 149
Right 1185094385 22:48798434-48798456 CCCAGAGCTGCCTAACGTTGGGG 0: 1
1: 0
2: 1
3: 11
4: 162
1185094379_1185094388 6 Left 1185094379 22:48798419-48798441 CCAAAGCCAGCGCGCCCCAGAGC 0: 1
1: 0
2: 1
3: 17
4: 149
Right 1185094388 22:48798448-48798470 ACGTTGGGGTTCATCCCATGAGG 0: 2
1: 0
2: 0
3: 8
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185094379 Original CRISPR GCTCTGGGGCGCGCTGGCTT TGG (reversed) Intronic
901757896 1:11452357-11452379 GCTCAGGGAGGAGCTGGCTTCGG + Intergenic
904236675 1:29121547-29121569 CATCTGGGGCGAGCTGGCATTGG + Exonic
904338127 1:29810997-29811019 GCTGTGGGTGGGGCTGGCTTTGG + Intergenic
905448340 1:38042099-38042121 GCTCTGGGCCGCGCAGGCGGCGG + Intergenic
911191697 1:94955107-94955129 GCTCTGGGGCTGTCTGGCTTGGG - Intergenic
912703068 1:111893065-111893087 GCTCTGGGCTGAGCTGGCTGAGG + Intronic
912776460 1:112509022-112509044 GGTCTGGGGCGCGCTGCCTGAGG - Exonic
916724926 1:167515003-167515025 GTCCTGGGGAGCTCTGGCTTAGG - Intronic
918732157 1:188012722-188012744 GCTCCTGGTCTCGCTGGCTTCGG + Intergenic
1070112075 10:73495912-73495934 GCTCTGGGCCGGGCGGGGTTGGG + Exonic
1070319820 10:75346180-75346202 GCTCTGGAGCCAGATGGCTTCGG + Intergenic
1074833159 10:117263904-117263926 GCTCTGGGGTGCGAGGACTTAGG + Intronic
1075710278 10:124527047-124527069 GCTCTGTGGCGGGCAGGCTCTGG - Intronic
1076394154 10:130126422-130126444 GCTCTCGGGCACGCTGGCAGGGG + Intergenic
1077035836 11:494137-494159 GCGCTGGGCCGCGCTGGGCTGGG + Intergenic
1077264376 11:1641808-1641830 GGTCTGGGGTGCGGTGGCCTGGG - Intergenic
1078246000 11:9573769-9573791 GCTCCGGGGCGCTCGGGCTGCGG - Exonic
1079004725 11:16783611-16783633 GCCCTGGGCCGGGCTGGCTGGGG - Intronic
1081644092 11:44777926-44777948 GCTCTGGGGCAAGCTGGCTCAGG + Intronic
1083228481 11:61300012-61300034 GCTCTGGGGGCAGCTGGCTTAGG + Exonic
1087890860 11:103536666-103536688 GCTATTGGGCGTGCTGGGTTTGG + Intergenic
1089046089 11:115503500-115503522 GCTGTGGGGCGGGCGGGCTGCGG + Intronic
1089700279 11:120240305-120240327 GCCTGGGGGGGCGCTGGCTTTGG + Intronic
1090089537 11:123682837-123682859 GCTCTGGAGCAGGCTGGCGTTGG - Intergenic
1091446430 12:546371-546393 TCTCTGGGGCCCTCTGGCCTTGG + Intronic
1092061145 12:5551523-5551545 GCTCTGGTGTTCACTGGCTTTGG + Intronic
1096615997 12:52833989-52834011 GCTCTGGGGGGCTTTGGCTTTGG - Exonic
1097246681 12:57611199-57611221 GCTCTGCGGAGCGCTGGGGTCGG - Intronic
1104127391 12:125861343-125861365 GCTCTGGGACTCGCGGGCTCTGG + Intergenic
1104688629 12:130807447-130807469 GCTCTGGGGTCCGCTTGCCTGGG - Intronic
1105943544 13:25171189-25171211 GCTCTGGGGGGCCCCGGGTTCGG + Exonic
1107939981 13:45374837-45374859 GCTTTGGGACCCGCTGGCTCAGG + Intergenic
1113760115 13:112840901-112840923 ACTCTGGGGCCCTCTGGATTTGG + Intronic
1113910705 13:113839958-113839980 GCTCTGAGGGGCGCAGGCTGAGG + Intronic
1113957455 13:114106984-114107006 GCTCTGGGGGGGCCTGGCTGAGG - Intronic
1121891056 14:97591110-97591132 GAACTGGAGCGAGCTGGCTTTGG + Intergenic
1123931004 15:25171650-25171672 GCCCTGGGACTCGCTGGCTTTGG + Intergenic
1123970623 15:25504732-25504754 GATCGGGGGCCAGCTGGCTTGGG + Intergenic
1125686765 15:41568217-41568239 GTTTTGGGGAGCGCTGGCTGGGG - Exonic
1128388198 15:67165352-67165374 GCTCTGGGGCTCGATGCCTGCGG - Exonic
1128497278 15:68205728-68205750 GCACCGGGGCTCGCAGGCTTGGG + Intronic
1129516119 15:76158828-76158850 ACTCTGAGGCCCCCTGGCTTTGG - Intronic
1129530480 15:76260723-76260745 GTTTTGGGGAGCGCTGGCTGGGG + Intronic
1129814514 15:78540289-78540311 GCTCTGGGGCGCTGCAGCTTAGG - Intergenic
1130511793 15:84595520-84595542 ACTCTGAGGCATGCTGGCTTCGG + Intergenic
1131200043 15:90388408-90388430 GCTCCGCGGCGCGGGGGCTTCGG + Intronic
1132114615 15:99126319-99126341 GCTCTGGGGCCCTCTAGCCTGGG + Intronic
1132607962 16:801325-801347 GCTCTGGGGCACGCTGCCTCGGG + Intergenic
1132772488 16:1571932-1571954 GCTCTGGGGGGCCCTGTCTGTGG + Intronic
1132849894 16:2020246-2020268 GCTCTGGGGCGCGCGGGCTCCGG - Exonic
1133234757 16:4382632-4382654 GCTCCTGGCCGCGCTGGCTGCGG + Exonic
1136240763 16:28942361-28942383 CCTCTGGGGCCGGCTTGCTTTGG + Intergenic
1136672717 16:31873064-31873086 CCTCTGGGCCGTGCTGGCTCAGG - Intergenic
1136779040 16:32885746-32885768 GCCCGGGGGCGCGCGGGCGTCGG + Intergenic
1136891578 16:33975772-33975794 GCCCGGGGGCGCGCGGGCGTCGG - Intergenic
1138125205 16:54432905-54432927 GCTTTGGGGGGCACTGGCTGGGG + Intergenic
1138738479 16:59280069-59280091 GCTCTGGGGAGCATAGGCTTTGG - Intergenic
1140091925 16:71845991-71846013 GCTGTGGGGGGCGCTGGGTGTGG + Exonic
1140475179 16:75236223-75236245 GCTCTGGGACGAGCCGGCTCTGG + Intronic
1140915351 16:79488372-79488394 GCTCTGGGGCGAGACTGCTTGGG + Intergenic
1140926573 16:79589821-79589843 GCCCTGGGGCGCGCTGGGTGTGG + Intronic
1141879919 16:86850950-86850972 GCTCTGGGGGAAGCTTGCTTTGG + Intergenic
1142271876 16:89094047-89094069 GCTCTCGGGGGCGCGGGCTCCGG + Intronic
1142293222 16:89202002-89202024 GCCCGGGGGCGCGCGGGCTCCGG + Intergenic
1203081453 16_KI270728v1_random:1147835-1147857 GCCCGGGGGCGCGCGGGCGTCGG + Intergenic
1143788214 17:9272591-9272613 GCTCGCTGGCGCGCTAGCTTCGG - Intronic
1144809343 17:17988764-17988786 GCTGTGGGCCGTGGTGGCTTAGG + Intronic
1144849541 17:18237060-18237082 GCTCTGGGTGGGGCTGGCTGGGG + Intronic
1147144947 17:38479376-38479398 GCCCTGGGGTGGGCTGGCTGTGG + Intronic
1147218576 17:38914981-38915003 GCTCTGGGAGGGGCTGGGTTTGG + Intronic
1147369168 17:39980046-39980068 GCTCTGGGCTGCGGTGGATTGGG - Intergenic
1147445949 17:40475407-40475429 GCTCTGGGGCCATCTGGGTTCGG + Intergenic
1151336559 17:73443488-73443510 GCCATGCGGCGCTCTGGCTTGGG - Intronic
1152206192 17:78975970-78975992 GCTCTGGGCAGAGCTGCCTTCGG - Exonic
1154127237 18:11702427-11702449 TCTCTGGGGTATGCTGGCTTGGG - Intronic
1155113272 18:22737422-22737444 TCTCTGGGGCTCGTTGGCTCTGG - Intergenic
1156400334 18:36733880-36733902 GCTCTCTGGCTCACTGGCTTGGG - Intronic
1156432554 18:37091865-37091887 GCTATGGGGAGCGCATGCTTTGG - Intronic
1156479539 18:37427375-37427397 GCCCTGGGGAGAGCTGGGTTTGG - Intronic
1157545151 18:48541205-48541227 GGGCTGGGGCGCGCTGGGCTTGG - Intronic
1158505807 18:58044826-58044848 GCTCCGGGGCGCTCCCGCTTTGG - Intronic
1159788455 18:72744582-72744604 GCACTGAGGCGAGCTAGCTTCGG - Intronic
1160668153 19:343228-343250 GCTCTGGGGGAGGCTGGCTTGGG + Intronic
1160738751 19:676459-676481 GCCCTGGGGGGCCCTGGCTTGGG + Exonic
1162438976 19:10681022-10681044 GCACTGCGGCTCGCTGCCTTCGG + Exonic
1162818428 19:13209345-13209367 GCTCAGAGGCGCGGTGGCTGCGG + Exonic
1163159907 19:15458236-15458258 GTTATGGAGCGAGCTGGCTTTGG + Intronic
1163535113 19:17872412-17872434 GCTGTGGGTCGGGCTGGCTCGGG + Exonic
926052973 2:9756583-9756605 GTTCTGGGGGTGGCTGGCTTGGG - Intergenic
930798699 2:55420048-55420070 GCCCGGGGGCGCGCTCGCTCGGG - Intergenic
935349604 2:102142348-102142370 GCTCTGGCGAGCGTTTGCTTCGG + Intronic
935640802 2:105288279-105288301 GCTCAGGGGTGCACTGGCTCAGG - Intronic
936278173 2:111118119-111118141 GCTGTGGGGCGCGCTCGCAGCGG - Exonic
938310320 2:130285122-130285144 GCTCTGGGGCTCCCAGGCTTCGG + Intergenic
938444612 2:131367247-131367269 GCCCTGGGGCTCCCAGGCTTCGG - Intergenic
946064473 2:216974798-216974820 GCTCAGGGGCGCGGTGGCTGAGG + Intergenic
947683753 2:232062084-232062106 GCTACGGGGCGGGCTGGGTTGGG + Intronic
1175529377 20:59663684-59663706 GCTCTGGGGCCGGCTGACCTGGG + Intronic
1175863863 20:62164197-62164219 GCTCCGCGGCGCCCTGGCTGTGG - Exonic
1175998234 20:62820818-62820840 GCTCTGGGGCTCGCTGACGTGGG + Intronic
1180783529 22:18534792-18534814 GCCCTGGGGAGGGCTGGCTCAGG - Intergenic
1181127096 22:20708843-20708865 GCCCTGGGGAGGGCTGGCTCAGG - Intronic
1181240431 22:21474144-21474166 GCCCTGGGGAGGGCTGGCTCAGG - Intergenic
1181968570 22:26673237-26673259 GCTCTGGGGGAGGCTGGCTGAGG - Intergenic
1182518198 22:30870807-30870829 TAGCTGGGGGGCGCTGGCTTTGG - Intronic
1183295002 22:37024230-37024252 GCTCTGCCGCGCGCTGGTGTCGG + Exonic
1184031826 22:41899741-41899763 GCTCTGGAGCGAGGTGACTTTGG - Intronic
1184218822 22:43085890-43085912 GCTCAGGAGCGGGCTGGCTCAGG + Intronic
1184274966 22:43404932-43404954 GCTCTGGGTGGTGCTGGTTTGGG + Intergenic
1184690194 22:46113970-46113992 GCTCTGGGGCGCGTCTGCTGCGG + Intergenic
1184867355 22:47209179-47209201 GCTCTGGAGCGTAGTGGCTTGGG + Intergenic
1184942762 22:47781166-47781188 GCTCTGAGTGGCGCGGGCTTTGG + Intergenic
1185094379 22:48798419-48798441 GCTCTGGGGCGCGCTGGCTTTGG - Intronic
1185316260 22:50180503-50180525 GCCCTGGGGCACACAGGCTTGGG + Intergenic
953877223 3:46673297-46673319 CCTCTGGGGGCCCCTGGCTTGGG + Intronic
958947928 3:100384964-100384986 GCTCTGTGGCAAGATGGCTTTGG - Intronic
960282215 3:115792093-115792115 GCTCGTGGTCTCGCTGGCTTCGG - Intergenic
962920133 3:139943161-139943183 ACTCTTGGGGGCTCTGGCTTGGG - Intronic
966635301 3:182126365-182126387 GCTTTGGGGAGCACTGGATTAGG + Intergenic
966905815 3:184525455-184525477 GCTCTGGCGGGCGCTGGGCTCGG - Intronic
967989816 3:195122541-195122563 GCTCTGGGGTGCTCAGGCATGGG - Intronic
968273265 3:197421139-197421161 GTTCTGGGGCGGGGTGGCTTTGG + Intergenic
968901780 4:3435510-3435532 GCTCTGGGGAGAGGGGGCTTTGG - Intronic
983264468 4:165493502-165493524 GCTCTGGGGCGAGATAGCTGAGG - Intronic
984192672 4:176624446-176624468 GCTCGTGGTCTCGCTGGCTTCGG + Intergenic
995650291 5:114361834-114361856 GCCCTGGAGCGCCCTGGCTCTGG + Intronic
995854908 5:116580481-116580503 TCTCTGGGGCTGTCTGGCTTTGG - Intergenic
997590716 5:135070474-135070496 GCTCTGGGGGGGCCTGACTTTGG + Intronic
999195422 5:149778439-149778461 GCTCTTGGGCTCCCTGGGTTGGG + Intronic
1001364498 5:171123055-171123077 GCTCTGGGGAGTGCATGCTTTGG - Intronic
1001856694 5:175017701-175017723 GCTCTGGGGCCAGTTGGATTAGG + Intergenic
1003046292 6:2736062-2736084 GCTTTGGGGCGTGCTGGTTTAGG - Intronic
1005157072 6:22819349-22819371 GCTCTGAGACATGCTGGCTTTGG - Intergenic
1006814291 6:36839963-36839985 GCTCCGGGGCGCCCGGGCTGCGG + Exonic
1007769181 6:44179726-44179748 GCTCTGGGGGTCACTGGGTTAGG + Intronic
1010777201 6:79901079-79901101 GTTCTGGGGTGAGCTGGCTGTGG - Intergenic
1011974907 6:93283639-93283661 GCTCCTGGTCTCGCTGGCTTCGG - Intronic
1019128880 6:169859416-169859438 GCACTGGGGCTCGCGGGCTCAGG - Intergenic
1022075080 7:26960538-26960560 GCTCTGGGTCTCGCTGCCCTGGG - Intronic
1024662430 7:51511145-51511167 ACTCTGGGACATGCTGGCTTAGG - Intergenic
1026302392 7:69109161-69109183 ACTCTGGGGAGAGCTGCCTTAGG + Intergenic
1034242491 7:149621234-149621256 GCCCTGGGGCGCCCTGGGGTTGG - Intergenic
1035174405 7:157040099-157040121 GCTCCGGGGGGGGCTGGCTGGGG + Intergenic
1035702146 8:1644260-1644282 GCTCTTGGTCGGGCGGGCTTAGG - Intronic
1037348326 8:17923220-17923242 CCTCTGGGGCGCGCCGCCCTAGG - Intronic
1037457060 8:19074069-19074091 GCTGCGGGGCGCGGTGGCTCGGG - Intronic
1038035432 8:23682724-23682746 GCTCCGGGTCGCGCTGTCTCTGG + Exonic
1038415133 8:27389558-27389580 GCTCAGAGGCCAGCTGGCTTGGG - Intronic
1039882053 8:41631059-41631081 TCACTGGGGAACGCTGGCTTTGG + Intergenic
1048303351 8:133267088-133267110 GGCCTGGGGCTGGCTGGCTTCGG - Intronic
1049383535 8:142329623-142329645 GCTCTGGGGTGCTCGGGCTCAGG - Intronic
1051304922 9:15699271-15699293 GCTCGTGGGCTCGCTGGCTCAGG + Intronic
1053592061 9:39524706-39524728 GCTTTGGGGTCAGCTGGCTTTGG + Intergenic
1053849919 9:42280065-42280087 GCTTTGGGGTCAGCTGGCTTTGG + Intergenic
1054574242 9:66840583-66840605 GCTTTGGGGTCAGCTGGCTTTGG - Intergenic
1056733749 9:89186595-89186617 GCACTGGGTCAGGCTGGCTTTGG - Intergenic
1057823451 9:98352713-98352735 GCTCTGGGGAGAGCATGCTTTGG + Intronic
1059068562 9:111110412-111110434 GCTCTGGGATGGGCTGGCTCTGG - Intergenic
1060155641 9:121318258-121318280 GCTCTGGGGGTCTCTGGCCTTGG + Intronic
1060302513 9:122383570-122383592 GCTCTGGGGCGGGATGCCTCGGG - Exonic
1060402952 9:123358697-123358719 GCTCTGGGGCTTCCTGGCTCTGG - Intronic
1061075745 9:128340556-128340578 GCTCTGTGGCTTGCCGGCTTCGG + Intergenic
1061517594 9:131098513-131098535 GCTCAGGGTCCCGCTGGCTGTGG - Intronic
1062388963 9:136326649-136326671 GCTGTGGGCCTCGCTGGCTGCGG + Intergenic
1189205783 X:39237621-39237643 GCTCTGTGGAGGGCTTGCTTGGG + Intergenic
1189888833 X:45577604-45577626 GCTCTGGGGAGCACAGGCTTTGG + Intergenic
1196319367 X:114269815-114269837 GCTCGTGGGCTCGCTGGCTTCGG + Intergenic
1199972909 X:152873703-152873725 GACCTGGGGTGCGCTGGCCTGGG - Intergenic