ID: 1185095237

View in Genome Browser
Species Human (GRCh38)
Location 22:48802815-48802837
Sequence CCCACAGAGGGTCCCGGCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185095237_1185095245 -7 Left 1185095237 22:48802815-48802837 CCCACGCCGGGACCCTCTGTGGG No data
Right 1185095245 22:48802831-48802853 CTGTGGGGCTTCAGGACTGCAGG 0: 1
1: 0
2: 3
3: 34
4: 340
1185095237_1185095250 19 Left 1185095237 22:48802815-48802837 CCCACGCCGGGACCCTCTGTGGG No data
Right 1185095250 22:48802857-48802879 CTGTGGGAGAGCGAGGCTGCAGG 0: 1
1: 0
2: 5
3: 185
4: 5772
1185095237_1185095251 29 Left 1185095237 22:48802815-48802837 CCCACGCCGGGACCCTCTGTGGG No data
Right 1185095251 22:48802867-48802889 GCGAGGCTGCAGGCTCCCGACGG 0: 1
1: 0
2: 1
3: 11
4: 156
1185095237_1185095248 12 Left 1185095237 22:48802815-48802837 CCCACGCCGGGACCCTCTGTGGG No data
Right 1185095248 22:48802850-48802872 CAGGTGCCTGTGGGAGAGCGAGG 0: 1
1: 0
2: 10
3: 36
4: 390
1185095237_1185095246 2 Left 1185095237 22:48802815-48802837 CCCACGCCGGGACCCTCTGTGGG No data
Right 1185095246 22:48802840-48802862 TTCAGGACTGCAGGTGCCTGTGG 0: 1
1: 0
2: 4
3: 38
4: 399
1185095237_1185095247 3 Left 1185095237 22:48802815-48802837 CCCACGCCGGGACCCTCTGTGGG No data
Right 1185095247 22:48802841-48802863 TCAGGACTGCAGGTGCCTGTGGG 0: 1
1: 0
2: 1
3: 37
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185095237 Original CRISPR CCCACAGAGGGTCCCGGCGT GGG (reversed) Intronic
No off target data available for this crispr