ID: 1185095410

View in Genome Browser
Species Human (GRCh38)
Location 22:48803625-48803647
Sequence GGCTGTTTGAGGAGGGCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 477
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 441}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185095393_1185095410 23 Left 1185095393 22:48803579-48803601 CCAGGAGATCCTCACTGCTCAGG 0: 1
1: 0
2: 0
3: 24
4: 281
Right 1185095410 22:48803625-48803647 GGCTGTTTGAGGAGGGCAGCTGG 0: 1
1: 0
2: 1
3: 34
4: 441
1185095405_1185095410 -8 Left 1185095405 22:48803610-48803632 CCTCCTCAGGTGGGAGGCTGTTT No data
Right 1185095410 22:48803625-48803647 GGCTGTTTGAGGAGGGCAGCTGG 0: 1
1: 0
2: 1
3: 34
4: 441
1185095399_1185095410 14 Left 1185095399 22:48803588-48803610 CCTCACTGCTCAGGGCCAGGGGC 0: 1
1: 1
2: 20
3: 104
4: 538
Right 1185095410 22:48803625-48803647 GGCTGTTTGAGGAGGGCAGCTGG 0: 1
1: 0
2: 1
3: 34
4: 441
1185095392_1185095410 24 Left 1185095392 22:48803578-48803600 CCCAGGAGATCCTCACTGCTCAG 0: 1
1: 0
2: 0
3: 30
4: 470
Right 1185095410 22:48803625-48803647 GGCTGTTTGAGGAGGGCAGCTGG 0: 1
1: 0
2: 1
3: 34
4: 441
1185095391_1185095410 25 Left 1185095391 22:48803577-48803599 CCCCAGGAGATCCTCACTGCTCA 0: 1
1: 0
2: 9
3: 297
4: 3003
Right 1185095410 22:48803625-48803647 GGCTGTTTGAGGAGGGCAGCTGG 0: 1
1: 0
2: 1
3: 34
4: 441
1185095403_1185095410 -1 Left 1185095403 22:48803603-48803625 CCAGGGGCCTCCTCAGGTGGGAG 0: 1
1: 0
2: 2
3: 35
4: 348
Right 1185095410 22:48803625-48803647 GGCTGTTTGAGGAGGGCAGCTGG 0: 1
1: 0
2: 1
3: 34
4: 441

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185095410 Original CRISPR GGCTGTTTGAGGAGGGCAGC TGG Intronic
900135591 1:1115761-1115783 GGGCGTCTGAGGAGGGCAGGGGG - Intronic
900857886 1:5200584-5200606 GGATGAGTGAGGAGGGCAGCAGG - Intergenic
901526745 1:9827879-9827901 GGGTGTTTGTGGAGCGGAGCCGG + Intergenic
902995559 1:20222329-20222351 GGCTGTTTGAAGGGAGAAGCAGG + Intergenic
903485116 1:23684096-23684118 GGCTGATGGAGGAGGGCAAATGG - Intergenic
903656082 1:24949682-24949704 GGCTGGGTGAGGTGGGCTGCTGG - Intronic
903888950 1:26557131-26557153 GGCTGGTACAGGAGGGAAGCCGG + Intronic
904382105 1:30118602-30118624 GGCCCTTGGAGGAGGACAGCAGG + Intergenic
904687840 1:32273788-32273810 GGCTGTGTGAGGGGAACAGCGGG + Intronic
904712006 1:32437196-32437218 GGCAGTTTGAGGATAGCACCAGG - Intergenic
904938613 1:34149410-34149432 GCCTGTTGGTGGGGGGCAGCTGG - Intronic
905434178 1:37945815-37945837 TGCTGTGTGAGGGGGACAGCCGG - Exonic
906203606 1:43975282-43975304 AGCTGCTTGAGGAGGGGTGCGGG + Intronic
906726664 1:48049175-48049197 AGCTGTCTGAGGAGGGCAGGAGG + Intergenic
906792512 1:48670993-48671015 GGTTGTTTGAGGAGGCAAGGGGG + Intronic
907872613 1:58456543-58456565 GGCTGAGTGAGGACGGCAGAAGG + Intronic
910429021 1:87143031-87143053 CGCTGTGTGAGGAGGGCGGCAGG - Intronic
912629092 1:111230976-111230998 GGATTTTAGAGGAGGGAAGCTGG + Intronic
913206406 1:116543225-116543247 GGCTGAGTAGGGAGGGCAGCAGG + Intronic
913247771 1:116885370-116885392 GGCGGTTTGTGCAGGGCAGTTGG - Intergenic
913550754 1:119915362-119915384 GGGTGCTGGAGGAGGTCAGCGGG - Exonic
913672114 1:121106703-121106725 TGCTGTTTCAGGGGGGCAGGCGG + Intergenic
914023879 1:143894061-143894083 TGCTGTTTCAGGGGGGCAGGCGG + Intergenic
914260882 1:145998198-145998220 GGCTGTCTGAGGAAGGAAGAAGG - Intergenic
914662368 1:149802099-149802121 TGCTGTTTCAGGGGGGCAGGCGG + Intronic
915304048 1:154967925-154967947 GGCTGTTTGAGGAGGTGAGTAGG - Intronic
915916413 1:159943458-159943480 GGCTGGGTGAGCAGGCCAGCTGG - Exonic
915934640 1:160083529-160083551 GGCTTTTTGGGGAGGGGGGCAGG - Intronic
916085599 1:161266800-161266822 AGCTGTTTAAGGACTGCAGCTGG + Intronic
916193081 1:162197944-162197966 GGAGGTATGAGGAGGGCAGATGG + Intronic
916378418 1:164181981-164182003 GGCTGGTGGGGTAGGGCAGCAGG - Intergenic
917676307 1:177322294-177322316 AGCTGCTTGAGGAAGGCAGAAGG - Intergenic
918440431 1:184561234-184561256 GTGTCTTTGAGGAGGGCAGTGGG - Intronic
918789870 1:188812825-188812847 GCCTGTCAGGGGAGGGCAGCTGG + Intergenic
919932372 1:202229667-202229689 GGCTCAGTGAGTAGGGCAGCAGG + Intronic
919987920 1:202688855-202688877 GGCTGGGTGAGGAGGCCACCCGG - Intronic
920283618 1:204862770-204862792 GGCAGTGTGAGGAGGGAGGCTGG + Intronic
920733529 1:208510970-208510992 GGCTGTTTGAAAAGGGGAGGTGG + Intergenic
921947183 1:220894277-220894299 GGCGGTTGGAGGCGGGCGGCCGG + Intergenic
923010261 1:230082963-230082985 GGATGATGGAGCAGGGCAGCTGG + Intronic
923010273 1:230083028-230083050 GGATGATGGAGGAGGGAAGCTGG + Intronic
923900106 1:238316858-238316880 GGATGTTTGAGTAGGAAAGCAGG - Intergenic
924363846 1:243268891-243268913 GGCTGTCAGAGTGGGGCAGCGGG + Intronic
924363865 1:243268979-243269001 GGCTGTCAGAGTGGGGCAGCGGG + Intronic
1065674918 10:28164208-28164230 TGCAGTTTGAGAAGGGAAGCAGG + Intronic
1065780333 10:29161019-29161041 GGCTGTGTGAGGATGGGAGCAGG + Intergenic
1066196648 10:33106710-33106732 GGCTCTTAGCGGAGGGGAGCTGG - Intergenic
1067256652 10:44648442-44648464 TTCTGTTTGAGGCTGGCAGCAGG - Intergenic
1068351069 10:55845914-55845936 GGCAGTGTGTGGGGGGCAGCAGG - Intergenic
1068955666 10:62817346-62817368 GGGTGTGTGAAGAGGGCAGCGGG - Intronic
1069365053 10:67687756-67687778 AGCTGTTCGAGGAAGGCAGAAGG + Intronic
1069893354 10:71665633-71665655 GGCTGCTTGAGGATGGACGCTGG + Intronic
1069925228 10:71845554-71845576 GGCTGTTTGGGGAGGGCCTGGGG + Intronic
1069981672 10:72256973-72256995 GGCTTTTTGTGCAGGGCACCAGG + Intergenic
1070750969 10:78963805-78963827 GGCTGCTTCCGAAGGGCAGCAGG - Intergenic
1070823763 10:79379307-79379329 GGGTCTCTGAGGAGGGCAGGTGG + Intergenic
1071293470 10:84203223-84203245 CTCTGTGTGAGGAGGGCAACCGG - Intronic
1071523719 10:86346404-86346426 GCCTGTGTTTGGAGGGCAGCTGG + Intronic
1071560344 10:86641804-86641826 GGCTGTTTGAGAAATGGAGCTGG + Intergenic
1072263204 10:93702354-93702376 GGGTGTGTGAGGAGGGCTGTGGG - Exonic
1072666093 10:97393632-97393654 GGCTTTTTGTGGAGGGGAGAAGG - Intronic
1072799841 10:98385266-98385288 GGCTTTTTGAGGAAGAAAGCAGG + Intronic
1073242337 10:102066679-102066701 TGGTGTTTGAGGAGGCCTGCGGG + Exonic
1073432389 10:103494609-103494631 GGCTGGGGGTGGAGGGCAGCCGG + Intronic
1074815344 10:117137917-117137939 GGCTCCTTGAGGAAGGCGGCTGG + Exonic
1074946730 10:118287178-118287200 AGCTGTTTGAGGAGTGCACCAGG + Intergenic
1075950050 10:126469363-126469385 GTCTGTTTTAAGAGGGCAGGAGG - Intronic
1076054847 10:127364080-127364102 GGGTGTTTGTGGAGTGCAGGGGG + Intronic
1076367691 10:129932820-129932842 GGTTGTTTGAGGATGACGGCTGG - Intronic
1077207107 11:1349985-1350007 GGCAGGTAGGGGAGGGCAGCAGG - Intergenic
1077507912 11:2940697-2940719 GGCTCTCTGAGGGTGGCAGCCGG - Intergenic
1077762615 11:5119442-5119464 GGGTGTTTGTGGAAGGCAGGTGG + Intergenic
1077905203 11:6527320-6527342 GGCTGGGGGAGGAGGGCAGGTGG + Intronic
1078463034 11:11529969-11529991 GGGTGCTTGAGCAAGGCAGCTGG + Intronic
1079764920 11:24380323-24380345 GGATTTTTGGGGAGGGCAGAGGG - Intergenic
1082906096 11:58310013-58310035 AGCTGCTTGAGGAAGGCAGAAGG + Intergenic
1084266898 11:68009833-68009855 GGTGGTAGGAGGAGGGCAGCAGG + Intronic
1085026431 11:73239276-73239298 GGGTGTGGGAGGAGGGAAGCAGG + Intergenic
1085201669 11:74705776-74705798 GCCTGGGTGGGGAGGGCAGCAGG + Intronic
1088972556 11:114786772-114786794 GGCTGTCTGTGTGGGGCAGCTGG - Intergenic
1089513678 11:119018049-119018071 GGCGGCTGTAGGAGGGCAGCGGG + Exonic
1090245769 11:125214878-125214900 GGCTTTTTGAGTGGGGAAGCAGG + Intronic
1090265850 11:125352393-125352415 GGCTGCTGGAGGAGTGCAGATGG - Intronic
1090718270 11:129449791-129449813 GGCTGAGTGAGAGGGGCAGCAGG + Intronic
1091231666 11:133991681-133991703 GGCTGTCTGCGGAGAGCAGTGGG + Intergenic
1091438723 12:495829-495851 GGTAGTGTGAGGAGTGCAGCAGG + Intronic
1092246667 12:6867801-6867823 GGCTGTGGGACGAGGGCCGCTGG + Intronic
1092246858 12:6868519-6868541 GGCTATTTTAGAAGGGAAGCAGG + Intronic
1096801867 12:54115718-54115740 GGCTGTGTCTGAAGGGCAGCAGG + Intergenic
1097168571 12:57099216-57099238 GGCAGGGAGAGGAGGGCAGCGGG + Intronic
1097863550 12:64541480-64541502 GGCTTTTTGAGCAGGGGAGGGGG + Intergenic
1102272830 12:111553838-111553860 GGGAGTTTGAGGTGGGCAGATGG - Intronic
1102405874 12:112673812-112673834 GGCTGTGTGGGGAGGGAAGTAGG - Intronic
1102947363 12:117001255-117001277 GGCCTTTGGTGGAGGGCAGCAGG - Intronic
1103273174 12:119690202-119690224 GGCTGTTTGAAGACAGCAGCAGG - Exonic
1104655160 12:130568925-130568947 GGCTGTGTGAGGAGGGCACGTGG - Intronic
1104746880 12:131216160-131216182 GGGTGTCTGGGGAGAGCAGCTGG - Intergenic
1104785737 12:131447023-131447045 GGGTGTCTGGGGAGAGCAGCTGG + Intergenic
1104975567 12:132550488-132550510 GGCTGCTCGGGGAGAGCAGCAGG + Intronic
1105442970 13:20430553-20430575 TGCTGCTGGAGGAGGGCAGGCGG - Intronic
1106241267 13:27915643-27915665 GGATGGTTGAGGAAGGAAGCTGG + Intergenic
1106522568 13:30510840-30510862 GACTGATTGAGGAGGGCTGGAGG - Intronic
1106857761 13:33871472-33871494 GGTAGTTGGAAGAGGGCAGCAGG - Intronic
1108148963 13:47511497-47511519 GGGTTTCTGAGGAGGGCAGAAGG - Intergenic
1108976717 13:56453574-56453596 GCCTGTTGGAGGAGAGCAGGAGG - Intergenic
1109995927 13:70125903-70125925 GGTTGTGGGAGGAGGGCAGAGGG + Intergenic
1113657245 13:112074687-112074709 CGTTGTTTGTGGAGAGCAGCAGG + Intergenic
1114654716 14:24309375-24309397 GGTTGCTTGGGGAGGGCACCAGG - Intronic
1116131124 14:40856420-40856442 AGCTGTTTCAGGAAGGCAGTGGG - Intergenic
1118843199 14:69527783-69527805 GGTTCTTTGAGGAGTGCATCCGG + Exonic
1119421037 14:74508238-74508260 GGCTGTGGGAGGTGGGCACCGGG + Intronic
1119484157 14:74977526-74977548 GGAGGTGAGAGGAGGGCAGCAGG - Intergenic
1119778685 14:77264124-77264146 GGCTGATAGAGGAGGGATGCAGG + Intergenic
1120861169 14:89256129-89256151 GGCAGTGTGAGGAGGGTGGCAGG - Intronic
1121507059 14:94485529-94485551 GGCTGGTGGAGGACCGCAGCAGG + Intergenic
1121853477 14:97245387-97245409 GGCCTTCTGAGGGGGGCAGCTGG + Intergenic
1122082223 14:99273941-99273963 GGGTGTTGGGGGTGGGCAGCCGG - Intergenic
1122309176 14:100783733-100783755 GTGTGGTTGAGGAGGGGAGCTGG + Intergenic
1122861985 14:104586826-104586848 GGGTGTTGGAGGAGGGAAGAGGG + Intronic
1122951554 14:105047809-105047831 GGCTGTGGGCGGAGGGCAGCAGG - Intergenic
1124095214 15:26642958-26642980 GGCCGTGTGAGGAGAGTAGCAGG - Intronic
1128661572 15:69505040-69505062 GGCAGGTCGTGGAGGGCAGCTGG + Intergenic
1129255427 15:74331446-74331468 GCCTGAATGAGGAGGGGAGCAGG - Intronic
1130011224 15:80154230-80154252 AAGTGTTTGAGGAGGGCAGAGGG - Intronic
1131048166 15:89329202-89329224 GGCTGTTTGAGGAGCTGAGGTGG - Intronic
1131626073 15:94122189-94122211 GGCTGTCAGGGGAGGGCAGGGGG - Intergenic
1132302929 15:100787685-100787707 GGGTGTGTGGGGAAGGCAGCAGG - Intergenic
1132550531 16:552191-552213 CGCTCTTCCAGGAGGGCAGCAGG + Exonic
1132571866 16:647762-647784 GGCTGTGGGAGGAGGGCAGTCGG - Exonic
1136048293 16:27632676-27632698 GGCTGGTTGGGAGGGGCAGCAGG + Intronic
1136264984 16:29110848-29110870 TGCTGTGTGATGGGGGCAGCTGG - Intergenic
1136265195 16:29112506-29112528 TGCTGTGTGATGGGGGCAGCTGG + Intergenic
1136344369 16:29665410-29665432 TGCTGGGTGAGGATGGCAGCAGG - Exonic
1136773045 16:32857959-32857981 GGCTGTGCTAGGAGGGCAGGCGG + Intergenic
1136897570 16:34003560-34003582 GGCTGTGCTAGGAGGGCAGGCGG - Intergenic
1137614834 16:49839849-49839871 GGCTGCTTCATGAGGGGAGCTGG - Intronic
1137758360 16:50920279-50920301 GGCTGTGTGAAGAGGGCAGCTGG + Intergenic
1141234340 16:82201419-82201441 TGATGTGTGAGGAGGTCAGCTGG + Intergenic
1141341947 16:83211752-83211774 GGCTGTTTGGGGGGGGGAGGTGG - Intronic
1142053777 16:87978823-87978845 TGCTGTGTGATGGGGGCAGCTGG - Intronic
1142053994 16:87980481-87980503 TGCTGTGTGATGGGGGCAGCTGG + Intronic
1203075470 16_KI270728v1_random:1120069-1120091 GGCTGTGCTAGGAGGGCAGGCGG + Intergenic
1142902328 17:3019855-3019877 GGGGGTTTGAGGAGGGCAGATGG - Intronic
1142934158 17:3313248-3313270 TATTATTTGAGGAGGGCAGCAGG + Intergenic
1143750652 17:9024462-9024484 GGCTGTTTGAGATGGGGAGATGG - Intronic
1143852327 17:9822153-9822175 GGCTGTGTGAGGATGCCAGATGG - Intergenic
1143876850 17:9998135-9998157 GGCAGCTTCAGGATGGCAGCTGG - Intronic
1144146883 17:12407225-12407247 GGCTAATTGAGAAGGCCAGCGGG - Intergenic
1144473287 17:15563272-15563294 AGTTGTCTGAGGAGGGCTGCTGG - Intronic
1144864710 17:18327770-18327792 GGCTGGTGCAGGAGTGCAGCTGG + Intergenic
1144872068 17:18377828-18377850 GGCTGGTGAAGGAGGGCAGGAGG - Exonic
1144923195 17:18781448-18781470 AGTTGTCTGAGGAGGGCTGCTGG + Intronic
1145281997 17:21475019-21475041 CGCTGTATGAGGAGGGGAGGAGG - Intergenic
1145395449 17:22490587-22490609 TGCTGTATGAGGAGGGGAGGAGG + Intergenic
1145804144 17:27714478-27714500 GGCCATTTGAGGAAGGCAGTAGG - Intergenic
1146598268 17:34188130-34188152 GGCAGTTTGGGGATAGCAGCAGG - Intergenic
1147166087 17:38594149-38594171 TGCTGTTTGTGCAGGGAAGCGGG + Intronic
1147885041 17:43678685-43678707 GGCTTTTAGAGAAGGGCAGCTGG + Intergenic
1147957851 17:44147246-44147268 GGCAGTTAGAGGAGAACAGCAGG - Intronic
1149427630 17:56570285-56570307 GGCTGTGAGAGGAGGGGAGATGG - Intergenic
1151568052 17:74911016-74911038 AGCTGCTTGAGGAAGGCAGAAGG - Intergenic
1151657232 17:75501787-75501809 GGCACCTTGAGGAGGGCAGCAGG + Exonic
1152210457 17:79000489-79000511 GGATGTTGGTGGGGGGCAGCTGG - Intronic
1152648519 17:81481451-81481473 GGCTGTTAGAGGACCGCAGCGGG - Intergenic
1153438091 18:5088116-5088138 AGCTGTTCGAGGAAGGCAGAAGG - Intergenic
1153747055 18:8190268-8190290 GGCTGTGTGGGGAGGGAGGCTGG - Intronic
1156938896 18:42741504-42741526 GGCGGTTTGGGGATAGCAGCAGG - Intergenic
1157451715 18:47794089-47794111 GGCAGTGAGAGGAGGCCAGCTGG + Intergenic
1158319168 18:56244475-56244497 TGCTGTTTGAGGAGGTGAGTAGG + Intergenic
1159716084 18:71825088-71825110 GGCTGTTTGGGTATGACAGCTGG - Intergenic
1160974702 19:1787094-1787116 GGCTCTTTGAGCAGGTGAGCAGG - Exonic
1161016521 19:1986286-1986308 GGCTGCTGGATCAGGGCAGCCGG - Exonic
1161080818 19:2309110-2309132 GCCTGTTTGAGGAAGGCTGAGGG - Intronic
1161106401 19:2445925-2445947 GGCTGGTTGGGGGGGGCAGCTGG - Intronic
1162109525 19:8392482-8392504 GCCAGTGTGGGGAGGGCAGCAGG - Intronic
1162430866 19:10627643-10627665 GGGTGTTTGCAGAGGGCAGATGG + Intronic
1163536872 19:17881939-17881961 TGCTGTGTGAGGAAGGCAGCGGG - Exonic
1163558862 19:18007498-18007520 GGCTCTTGGAGGAGTCCAGCTGG + Intronic
1164155463 19:22593918-22593940 GGTTGTTAGAGGAGGGAAGTGGG + Intergenic
1165078910 19:33296700-33296722 GGCTGTGAGGGGAGGGAAGCTGG - Intergenic
1165509961 19:36260349-36260371 GGCAGTTTGGGGATGGCACCAGG + Intergenic
1166257744 19:41618581-41618603 GCCTGGGTGAAGAGGGCAGCAGG + Intronic
1166679057 19:44756494-44756516 GTCTGATGGAGGAGGGCTGCGGG + Intronic
1168165470 19:54544223-54544245 GCCTGTCAGAGGAGGGCAGGGGG - Intronic
1168717741 19:58539067-58539089 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717750 19:58539106-58539128 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717756 19:58539145-58539167 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717765 19:58539184-58539206 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717773 19:58539223-58539245 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717782 19:58539262-58539284 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717790 19:58539301-58539323 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717818 19:58539454-58539476 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717827 19:58539493-58539515 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717836 19:58539532-58539554 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717845 19:58539571-58539593 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717851 19:58539610-58539632 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717860 19:58539649-58539671 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717878 19:58539724-58539746 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717887 19:58539763-58539785 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717896 19:58539802-58539824 CCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717908 19:58539842-58539864 CTCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717942 19:58539995-58540017 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717951 19:58540034-58540056 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717960 19:58540073-58540095 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717979 19:58540151-58540173 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717990 19:58540190-58540212 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717996 19:58540229-58540251 TCCTGTATGAGGAGGGAAGCAGG - Intergenic
1168718005 19:58540268-58540290 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718014 19:58540307-58540329 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718025 19:58540344-58540366 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718036 19:58540383-58540405 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718045 19:58540422-58540444 CCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718057 19:58540459-58540481 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718077 19:58540537-58540559 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718099 19:58540615-58540637 TCCTGTATGAGGAGGGAAGCAGG - Intergenic
1168718108 19:58540654-58540676 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718118 19:58540693-58540715 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718151 19:58540846-58540868 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718160 19:58540885-58540907 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718169 19:58540924-58540946 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718178 19:58540963-58540985 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718187 19:58541002-58541024 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718198 19:58541041-58541063 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718217 19:58541119-58541141 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718228 19:58541158-58541180 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718239 19:58541197-58541219 TCCTGTATGAGGAGGGAAGCAGG - Intergenic
1168718248 19:58541236-58541258 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718257 19:58541275-58541297 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718268 19:58541312-58541334 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718279 19:58541351-58541373 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718288 19:58541390-58541412 CCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718300 19:58541427-58541449 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718311 19:58541466-58541488 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718318 19:58541505-58541527 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718327 19:58541544-58541566 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718336 19:58541583-58541605 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718343 19:58541622-58541644 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718352 19:58541661-58541683 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718361 19:58541700-58541722 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718379 19:58541775-58541797 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718388 19:58541814-58541836 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718397 19:58541853-58541875 CCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718444 19:58542045-58542067 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718453 19:58542084-58542106 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718462 19:58542123-58542145 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718471 19:58542162-58542184 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718480 19:58542201-58542223 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718489 19:58542240-58542262 CCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718512 19:58542319-58542341 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718521 19:58542358-58542380 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718530 19:58542397-58542419 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718539 19:58542436-58542458 CCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718585 19:58542628-58542650 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718594 19:58542667-58542689 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718603 19:58542706-58542728 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718619 19:58542784-58542806 CCCTGTCTGAGGAGGGAAGCAGG - Intergenic
924974768 2:162585-162607 GGGCGTGTCAGGAGGGCAGCGGG - Intergenic
925104428 2:1278389-1278411 TGCTGTTTATGGAGGGCACCAGG + Intronic
925907421 2:8547726-8547748 GGGTGTTGGAGGAGGGCACCAGG - Intergenic
925952991 2:8933454-8933476 AGCTACTTGAGGAGGGCAGGAGG - Intronic
926492115 2:13537515-13537537 AGTTGTTTGAGGAGGGGAGGAGG + Intergenic
927050257 2:19321234-19321256 CTCTGCTTGAGGAGGGCACCGGG + Intergenic
927179188 2:20432292-20432314 GGCTGTTTCAGGAAGGGAGTGGG + Intergenic
927851534 2:26503121-26503143 GGATGCTGGGGGAGGGCAGCCGG + Intronic
931008960 2:57885809-57885831 GCCAGTTTGAAGAGGGCAGAGGG - Intergenic
931216219 2:60247469-60247491 GGCTGTCCCAGGAGGGCGGCTGG - Intergenic
931321963 2:61180588-61180610 CGCTGCTGGAGGAGAGCAGCTGG - Intronic
937006947 2:118525555-118525577 GGCTGTTTGAAGAGGATGGCAGG - Intergenic
937218374 2:120327172-120327194 GGCTGTTGGAGCTGGGCAGTGGG - Intergenic
937276143 2:120685402-120685424 GGGAGTGTGAAGAGGGCAGCAGG + Intergenic
937892439 2:126948786-126948808 TGTTGTTTGAGGAGGGCAGTGGG + Intergenic
937916403 2:127101182-127101204 GGGTGTTTGTGCAGGGCAGGTGG - Intronic
939719290 2:145627909-145627931 GGCATTTTGAGGAGGGGGGCAGG - Intergenic
943689151 2:190851202-190851224 GGCTATTTAAGTGGGGCAGCTGG - Intergenic
943748960 2:191491293-191491315 GGGAATTTGAGGGGGGCAGCAGG - Intergenic
946023414 2:216657243-216657265 GCCTGTCTGGGAAGGGCAGCGGG + Intronic
946090474 2:217218276-217218298 GGCTGTTTGGTGAGGGAAGGAGG - Intergenic
947177971 2:227386366-227386388 GGCAGTTTTAGGTGGGCAGGAGG - Intergenic
947625639 2:231616504-231616526 GACTGATGGAGGAGGGAAGCAGG - Intergenic
947819133 2:233058687-233058709 GGATGTTGGTGGAGGCCAGCAGG + Intergenic
948391063 2:237611803-237611825 GGCAGTTTGAGGATAGCACCAGG - Intergenic
948835804 2:240625484-240625506 GGCTGTCTGAGAAGGGCTGGGGG - Intronic
949009798 2:241671972-241671994 GGCAGGGTGAGGAGGGCAGGGGG - Intronic
1168974174 20:1951767-1951789 GGCTGTGTGAGCTGGGCAGGAGG - Intergenic
1169208640 20:3753784-3753806 GGCTGTCTGAGGAAGGGAGAGGG - Exonic
1169263142 20:4152114-4152136 GGCTGTATGCCGAGGGCAGCCGG + Intronic
1171191601 20:23163059-23163081 AGCTGTCTGAGGAGAGCAGGAGG + Intergenic
1171794844 20:29558748-29558770 GGCTGTGTCTGAAGGGCAGCAGG - Intergenic
1171853612 20:30325517-30325539 GGCTGTGTCTGAAGGGCAGCAGG + Intergenic
1172605808 20:36212749-36212771 GGCTGCTTGAGGAGAGAAGAGGG + Intronic
1173410095 20:42802409-42802431 GGCTGTTGGAGTTGGGCAGAGGG - Intronic
1173703421 20:45093083-45093105 GTCTGTTTGTGGGTGGCAGCGGG + Exonic
1174048130 20:47748217-47748239 GGACGTTGGAGGAGGGCAGCAGG - Intronic
1174393249 20:50231204-50231226 GGCTGTCTGGGGAAGGCAGGTGG - Intergenic
1174433545 20:50489036-50489058 GGCCATGTGAGGAAGGCAGCAGG - Intergenic
1176082505 20:63281122-63281144 GGCTGCTGGAGGAGTGCAACTGG - Intronic
1176873085 21:14099617-14099639 GGCTTTTGGAGGAGAGCAGGAGG + Intergenic
1177638387 21:23815448-23815470 GACTGGCTGAGGAGGGAAGCTGG - Intergenic
1178512353 21:33216078-33216100 GGGTGGCTAAGGAGGGCAGCTGG + Intergenic
1178837261 21:36109272-36109294 GGTGGTGGGAGGAGGGCAGCAGG - Intergenic
1179711905 21:43268316-43268338 GGCTGGTGGGGGAGGGAAGCAGG + Intergenic
1180728672 22:17964849-17964871 GGCTGGTTCAGGAGGGCTGGGGG + Intronic
1181849765 22:25741829-25741851 AACTGTTTGAGGAGGAGAGCTGG - Intergenic
1181861534 22:25823060-25823082 GGTTGGGGGAGGAGGGCAGCAGG + Intronic
1181917634 22:26293164-26293186 GGCTGTTTCAGGATGGCTTCAGG - Intronic
1182658101 22:31905677-31905699 GGCTGGATGAAGAGTGCAGCCGG + Intronic
1183042450 22:35192521-35192543 GGCTGTCAGAGGAGGACTGCTGG - Intergenic
1183098753 22:35570573-35570595 GGCTGTTAGTGGAGGGCCCCTGG + Intergenic
1183724659 22:39581690-39581712 GGCAGTTTGAGGGAGGCAGCAGG - Intronic
1184057695 22:42063353-42063375 GGTTGGGAGAGGAGGGCAGCAGG - Intronic
1184218059 22:43080505-43080527 GGCAGCTTGAGAAGGCCAGCTGG - Intronic
1184255937 22:43287034-43287056 GGGTGTGTGATGGGGGCAGCGGG + Intronic
1185095410 22:48803625-48803647 GGCTGTTTGAGGAGGGCAGCTGG + Intronic
1185162075 22:49236027-49236049 GGCTCCTTGAGAAGGGCAGGTGG + Intergenic
1185341564 22:50293484-50293506 GGCTGGGAGGGGAGGGCAGCAGG - Intronic
950077248 3:10195886-10195908 GGCAGTTTGAGGAGGGAGGGTGG + Intronic
951239496 3:20272343-20272365 AGCTGCTTGAGGAAGGCAGAAGG - Intergenic
952218926 3:31304728-31304750 GGCTGTTTCAGGATGGAGGCTGG - Intergenic
952337943 3:32421054-32421076 GGGTGGGAGAGGAGGGCAGCAGG - Intronic
952964713 3:38614112-38614134 GGCTGGTCGGGGAGGGCAGGCGG - Intronic
954105654 3:48408569-48408591 GGATGTGTGAGGAGGGGAGCTGG - Intronic
954417307 3:50399633-50399655 GGCTGTGAAAGGAGGGGAGCAGG - Intronic
955072348 3:55582400-55582422 CACTGTTTGAGGAGGAGAGCAGG - Intronic
955928247 3:64029167-64029189 GGATGTTGGAGGAGAGCAGCCGG + Intergenic
956610195 3:71114749-71114771 GGCTGTCTGAGTGGGGCATCTGG + Intronic
956642816 3:71430808-71430830 GGCTGTTGGGGGAGGGGAGGCGG + Intronic
956782982 3:72619026-72619048 CGGTTTCTGAGGAGGGCAGCTGG + Intergenic
957991047 3:87627804-87627826 GGCAGTTTGGTGAGGGCAGTCGG + Intergenic
958183238 3:90085920-90085942 GGCGGTTTGGGGATAGCAGCAGG - Intergenic
958676339 3:97273278-97273300 GGCAGTTTGGGGATGGCACCAGG + Intronic
960637878 3:119801821-119801843 TGCTGTTTGGTGAGGGCGGCCGG + Intronic
961314284 3:126023913-126023935 GGCAGCTTGAGGATGGCATCAGG - Intronic
961683012 3:128611508-128611530 GGCTGTCAGAAGAGGGCAGAAGG - Intergenic
961800055 3:129440440-129440462 GCGTGTTTGAGGGGGGCAGCGGG + Intronic
962606294 3:137035390-137035412 GGGTGTGTGAGGGGGGCATCGGG + Intergenic
963372838 3:144423360-144423382 GGATTTTGGAGGAGGGAAGCAGG + Intergenic
963776795 3:149448082-149448104 GGCTGTTTGAGAAGGCCTGTGGG + Intergenic
965336739 3:167436285-167436307 GGCGGTTTGGGGATAGCAGCAGG - Intergenic
966170485 3:177074623-177074645 GTCTGTTTGAAAAGGGCAGTGGG - Intronic
968007252 3:195251426-195251448 GGCTGTATGAGAAGGGCCGGGGG - Intronic
968254919 3:197260891-197260913 GGTTTTTTGAGAAGGGGAGCAGG + Intronic
968558377 4:1261892-1261914 GGCTGTTTGAGCAGGGAATTGGG + Intergenic
968632149 4:1657237-1657259 AGCCGTTGGAGGACGGCAGCAGG + Intronic
969497514 4:7534605-7534627 GGGTCCTTGTGGAGGGCAGCAGG + Intronic
969868056 4:10088021-10088043 GACTGTTTGAGTAGGACAGAAGG + Intronic
970286858 4:14527412-14527434 GCCTGTTTGGGGAGGGTGGCAGG + Intergenic
970658657 4:18260380-18260402 GGATGTTGGAGGAGGGCAGTGGG - Intergenic
970853617 4:20630600-20630622 GGCAGTTTGAGGATAGCACCAGG + Intergenic
975048014 4:69827508-69827530 AGCTGCTTGAGGAAGGCAGAAGG - Intronic
975415409 4:74099144-74099166 GGCTGTGCGAGGAGGAGAGCTGG + Exonic
975800716 4:78057260-78057282 GCCTGGGTGAGGAGGGCTGCGGG - Intergenic
976556110 4:86453145-86453167 GGGTCCTTGAGGAGGGCTGCTGG + Intronic
976751931 4:88457589-88457611 GGCTGTGAGGGGCGGGCAGCCGG + Intronic
977317014 4:95463049-95463071 GCATGTTTGAGGGCGGCAGCTGG - Intronic
977609989 4:99021420-99021442 GGCTGCTGCAGCAGGGCAGCTGG + Intronic
977622850 4:99156582-99156604 GAATGTTTGAGGCGGGCACCAGG - Intronic
977650263 4:99461023-99461045 GGCTGTATGAAGAGGGCCTCAGG - Intergenic
977718132 4:100207178-100207200 GGTTGTTAGAGGAGGGAAGTGGG + Intergenic
977916520 4:102600416-102600438 GTATTTTGGAGGAGGGCAGCAGG + Intronic
978839026 4:113187276-113187298 GGGAGTTAGAGGAGGGAAGCAGG + Intronic
981466091 4:145074306-145074328 CTCTTTTTGAGGAGGGCAGAGGG + Intronic
983063467 4:163183993-163184015 GTGTGTCTGAGGAGGGAAGCAGG - Intergenic
983883420 4:172957419-172957441 GGAAGTTTCAGCAGGGCAGCGGG + Intronic
983963125 4:173778370-173778392 GGCTGTTGGTGGAGCACAGCAGG - Intergenic
985758857 5:1734529-1734551 GCCTGTTGAAGGAGGCCAGCAGG - Intergenic
988435734 5:31173056-31173078 GGCTGAGTCAGGAGGGTAGCTGG - Intergenic
988548174 5:32176658-32176680 GGCTGGGGGTGGAGGGCAGCTGG - Intergenic
990116749 5:52399968-52399990 AGCTGCTTGAGGAAGGCAGAAGG - Intergenic
991236090 5:64398991-64399013 GGCGTGTTGAGGAGGGTAGCAGG + Intergenic
994231716 5:97315594-97315616 AGCTGCTTGAGGAAGGCAGAGGG + Intergenic
995210338 5:109530616-109530638 GGCTGTCTGTGGAGGGCTGGAGG - Intergenic
996528413 5:124501889-124501911 GGCAGTTTGAGGATAGCACCAGG - Intergenic
996898952 5:128521358-128521380 GCCTGTCTGGGGAGGGCAGGGGG + Intronic
997072412 5:130636269-130636291 AGCTGCTTGAGGAAGGCAGAAGG - Intergenic
997678343 5:135731824-135731846 GGCTGTTTGGGGATAGCACCAGG + Intergenic
998165198 5:139838739-139838761 GGGTGGTGCAGGAGGGCAGCAGG - Exonic
1000288545 5:159848308-159848330 GGCTTTTTGGGGAAGGCAGAAGG + Intergenic
1000393525 5:160749425-160749447 CACAGTATGAGGAGGGCAGCTGG - Intronic
1000519029 5:162276259-162276281 GGCAGTTTGGGGATGGCACCAGG + Intergenic
1001686054 5:173595869-173595891 GTCAGTTGGAGGGGGGCAGCTGG - Intergenic
1002051440 5:176573878-176573900 GGCTGTGTGGGGAGGGGAGGAGG + Intronic
1002071423 5:176680732-176680754 GGGTGACTGAAGAGGGCAGCCGG - Intergenic
1002135865 5:177107206-177107228 TGCTGTGTGACGTGGGCAGCAGG - Intergenic
1002774641 6:318434-318456 GGCTGCTGGAGGAGGGCCACAGG - Intronic
1003805801 6:9724971-9724993 AGCTGCTTGAGGAAGGCAGAAGG - Intronic
1004221099 6:13747108-13747130 GGGTGTTTGAGGGCGGCAGTTGG + Intergenic
1004531374 6:16458357-16458379 AGCTGCTTGAGGAAGGCAGTAGG - Intronic
1005082104 6:21966442-21966464 GGATGTTTGAGGGGAGCTGCAGG - Intergenic
1005631049 6:27708395-27708417 AGATGTTTGGGGAGGGCAGATGG - Intergenic
1006420497 6:33930986-33931008 GCCGGTGTGAGGAGGGCAGCAGG + Intergenic
1007399589 6:41596279-41596301 GGCTGTTTGAGGTCGGGAGAAGG - Intronic
1007951919 6:45880199-45880221 GGGTGTTTGCAGAGGGCACCAGG + Intergenic
1008583433 6:52927178-52927200 GGTTGGGGGAGGAGGGCAGCAGG - Intergenic
1008775477 6:55032417-55032439 GGGTCCTTGAGGAGGGCTGCTGG - Intergenic
1009359731 6:62796600-62796622 GGCAGTTTGAGGATAGCACCAGG - Intergenic
1010804102 6:80214501-80214523 GTCTGTTTGAGGGGAGCAGAGGG + Intronic
1011625408 6:89279267-89279289 GTCTGTGTGAGGCAGGCAGCGGG + Intronic
1011798608 6:90983817-90983839 GGCTGTGTGAAGAGGGAGGCAGG - Intergenic
1012491385 6:99786374-99786396 GGCTGTTTCACGTGTGCAGCAGG + Intergenic
1012572571 6:100747711-100747733 GGGTGTTTGAGGACAGCAGGAGG + Intronic
1014614300 6:123583155-123583177 GGCAGTTTGGGGATGGCACCAGG + Intronic
1014767349 6:125422073-125422095 GGATGTCTCAGGAGTGCAGCCGG - Intergenic
1015800915 6:137061438-137061460 GGCTGTTTGGGGATAGCACCAGG + Intergenic
1018066438 6:160127780-160127802 GGGTGTTTCAGGAAGGCGGCAGG + Intronic
1018774132 6:166998595-166998617 GGCTGTCGGCGGAGGGCCGCGGG + Intergenic
1019341206 7:509962-509984 GGCTGCTTTAGGGGGGAAGCCGG + Intronic
1019373538 7:676571-676593 CCCTATTTGAGGAAGGCAGCCGG + Intronic
1019629936 7:2043673-2043695 GGCTGTTTGTGGTGGGAAACAGG - Intronic
1019897332 7:3992447-3992469 GGTGGATTGAGGAGGGCAGAGGG + Intronic
1020066710 7:5193941-5193963 ATATGTTTGAGGAGGGCAGGGGG + Intronic
1021356576 7:19658368-19658390 AGCTGCTTGAGGAAGGCAGAAGG + Intergenic
1023281388 7:38574375-38574397 TGCTGTTTGAGAGGGGCCGCTGG - Intronic
1023806917 7:43878874-43878896 AACTGTCTGAGGAGAGCAGCAGG + Exonic
1024621213 7:51159078-51159100 GGAGCTTGGAGGAGGGCAGCGGG + Intronic
1025801322 7:64789218-64789240 AGGTGTGGGAGGAGGGCAGCAGG - Intergenic
1025976799 7:66376803-66376825 GGCTGTTTGGAGACGGGAGCTGG + Intronic
1027234054 7:76287330-76287352 GGGAGATTCAGGAGGGCAGCGGG + Intergenic
1028477133 7:91264966-91264988 GGCTGGCGGAGGAGGGCAGCGGG + Exonic
1031359710 7:120834443-120834465 TGCTTTTTGATGAGGGCTGCAGG + Intronic
1032153688 7:129451379-129451401 GGCTGTGTGTGGAGGACAGAGGG + Intronic
1032239156 7:130147910-130147932 GGGAGTCTGAGGCGGGCAGCAGG + Intergenic
1033547881 7:142418468-142418490 GGTTGTTTCATGAGCGCAGCTGG - Intergenic
1033664832 7:143430298-143430320 GGCTGTCTGAGGATGGGAGGGGG + Intergenic
1034115285 7:148578638-148578660 GGCTGGCTGAGGACGGCGGCTGG + Intergenic
1034275656 7:149822752-149822774 GGCTGTGAGGGGAGGGGAGCAGG - Intergenic
1034551264 7:151822269-151822291 GGTGGGTTCAGGAGGGCAGCAGG + Intronic
1035454589 7:158999699-158999721 GGCGGTTTGAGGAGGGAAGATGG - Intergenic
1035941603 8:3907784-3907806 GGCTGTTTGATACGAGCAGCGGG - Intronic
1036143253 8:6227527-6227549 GGGGGTGTGAGGGGGGCAGCAGG - Intergenic
1037308873 8:17534176-17534198 GGCTATTTAAAAAGGGCAGCAGG + Intronic
1038376659 8:27046817-27046839 GGGAGATTGAGGAGGGCAGATGG + Intergenic
1038412084 8:27366804-27366826 GGCTGTGTGTGGAGAGCAGAGGG + Intronic
1040046286 8:42967258-42967280 AGGTGTGTGTGGAGGGCAGCCGG - Intronic
1041738251 8:61133472-61133494 GGCTGTTTATGGAGGTGAGCTGG + Intronic
1042012802 8:64267062-64267084 TGCAGTTTGAAGAGGGCAGGCGG - Intergenic
1042774160 8:72411155-72411177 GCCTGTTAGGGGAGGGCAGGTGG + Intergenic
1043130594 8:76456080-76456102 GACTGTGTGCGGAGGGCAGGGGG - Intergenic
1043257056 8:78150251-78150273 AGCTGCTTGAGGAAGGCAGAAGG - Intergenic
1043425819 8:80147667-80147689 GGGTTGTTGAGCAGGGCAGCAGG + Intronic
1045858552 8:106791233-106791255 AGCTGCTTGAGGAAGGCAGAAGG - Intergenic
1047000489 8:120568198-120568220 GGCTCTCTGAGGTGGGAAGCTGG - Intronic
1048209678 8:132444268-132444290 GGCTGGGTGAGGAGGGCAGGAGG - Intronic
1049201503 8:141342760-141342782 GGCTGTCTGAGGATGGGAGATGG + Intergenic
1049345420 8:142136118-142136140 GGCTTTCTGCGGAGGGCACCTGG - Intergenic
1049707405 8:144049259-144049281 GGGTGGCTGAGGAGGGCGGCGGG + Intergenic
1049812753 8:144582793-144582815 GGCTGGTGGTGGAGGGCTGCAGG + Intronic
1050286252 9:4105348-4105370 AGCTGTTTGACAAGTGCAGCAGG + Intronic
1051477312 9:17522318-17522340 GGCTGTTTGAGGAATGAAACCGG - Intergenic
1051591101 9:18777309-18777331 GGCTGCTGGAGCAGGGCGGCTGG + Exonic
1056706376 9:88955513-88955535 GGCTGTTTGAGGGAGGCCACTGG + Intergenic
1056760721 9:89412699-89412721 GGCCATTTGAGAAGAGCAGCAGG - Intronic
1057303439 9:93899474-93899496 CTCTGTATGAGGAGGGGAGCTGG - Intergenic
1059385114 9:113958553-113958575 GGCTCTGTGAGGTGGGCAGTGGG + Intronic
1059749252 9:117232429-117232451 GGCTGCTTTTGGAGGGCAGCTGG - Intronic
1059862953 9:118485485-118485507 AGTTGTTTGAGAAGGGCAGAAGG - Intergenic
1060193479 9:121607896-121607918 GGCTGTTTGCCGGGAGCAGCAGG + Intronic
1060403230 9:123360440-123360462 GGCGGGGTGTGGAGGGCAGCAGG - Intronic
1060945290 9:127566875-127566897 GGGTGTTGGAAGGGGGCAGCGGG - Intronic
1061290993 9:129650107-129650129 GGCTGTTCGAGGAGGAGAGCTGG + Intergenic
1061711873 9:132493547-132493569 GGCTCCTGGGGGAGGGCAGCAGG + Intronic
1061893724 9:133636203-133636225 GCCAATTAGAGGAGGGCAGCAGG + Intergenic
1185473704 X:400480-400502 CGCTATTTTTGGAGGGCAGCTGG + Intergenic
1185524835 X:769825-769847 GAATGTTTGGGGTGGGCAGCGGG + Intergenic
1186416908 X:9391777-9391799 GGCTGTGGGTGGAGGGCAACGGG + Intergenic
1187391617 X:18890047-18890069 GGCTTTTTGAGGGAGACAGCAGG + Intergenic
1187887943 X:23907208-23907230 GGCTGGGTGACGAGGGAAGCTGG - Intronic
1188225477 X:27592243-27592265 GGCTGTGTGAGGATGCCAGATGG - Intronic
1189891333 X:45605547-45605569 GCCTGTTGGCGGAGGGCAGCGGG - Intergenic
1190735902 X:53255961-53255983 GGCTGCTGGAGGGGGGCAGCTGG + Exonic
1192554623 X:72079934-72079956 GGCTGTGGGTGGAGTGCAGCGGG + Intergenic
1193056519 X:77157885-77157907 GCCTGTCAGAGGAGGGCAGTGGG + Intergenic
1193549403 X:82872033-82872055 GGGTGTTGGAGGATGGAAGCAGG + Intergenic
1194758405 X:97765014-97765036 GTATGTTTAAGGAGGGAAGCTGG + Intergenic
1195072078 X:101291128-101291150 GGCTGGCTGGGGAGGGCTGCGGG + Intronic
1195322131 X:103728691-103728713 GGCTGTTTGGGGAGGGCCAGAGG + Intergenic
1201012017 Y:9556828-9556850 GGCTGAATGAGGATGGCAGAGGG + Intergenic
1201733952 Y:17236876-17236898 GGCAGTTACAGGAAGGCAGCAGG + Intergenic