ID: 1185095643

View in Genome Browser
Species Human (GRCh38)
Location 22:48804627-48804649
Sequence TGTCCTGGAGGACCACAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 7, 3: 17, 4: 261}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185095628_1185095643 30 Left 1185095628 22:48804574-48804596 CCACCTGTCTGGCCACCAGGGCG 0: 1
1: 0
2: 2
3: 14
4: 196
Right 1185095643 22:48804627-48804649 TGTCCTGGAGGACCACAGGCTGG 0: 1
1: 0
2: 7
3: 17
4: 261
1185095636_1185095643 0 Left 1185095636 22:48804604-48804626 CCCCTTTGGCCTAGGCTGACGAT 0: 1
1: 0
2: 0
3: 1
4: 47
Right 1185095643 22:48804627-48804649 TGTCCTGGAGGACCACAGGCTGG 0: 1
1: 0
2: 7
3: 17
4: 261
1185095629_1185095643 27 Left 1185095629 22:48804577-48804599 CCTGTCTGGCCACCAGGGCGATA 0: 1
1: 0
2: 15
3: 921
4: 22859
Right 1185095643 22:48804627-48804649 TGTCCTGGAGGACCACAGGCTGG 0: 1
1: 0
2: 7
3: 17
4: 261
1185095637_1185095643 -1 Left 1185095637 22:48804605-48804627 CCCTTTGGCCTAGGCTGACGATT 0: 1
1: 0
2: 0
3: 4
4: 63
Right 1185095643 22:48804627-48804649 TGTCCTGGAGGACCACAGGCTGG 0: 1
1: 0
2: 7
3: 17
4: 261
1185095638_1185095643 -2 Left 1185095638 22:48804606-48804628 CCTTTGGCCTAGGCTGACGATTG 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1185095643 22:48804627-48804649 TGTCCTGGAGGACCACAGGCTGG 0: 1
1: 0
2: 7
3: 17
4: 261
1185095635_1185095643 1 Left 1185095635 22:48804603-48804625 CCCCCTTTGGCCTAGGCTGACGA 0: 1
1: 0
2: 0
3: 4
4: 52
Right 1185095643 22:48804627-48804649 TGTCCTGGAGGACCACAGGCTGG 0: 1
1: 0
2: 7
3: 17
4: 261
1185095630_1185095643 18 Left 1185095630 22:48804586-48804608 CCACCAGGGCGATAGTCCCCCCT 0: 1
1: 0
2: 0
3: 3
4: 73
Right 1185095643 22:48804627-48804649 TGTCCTGGAGGACCACAGGCTGG 0: 1
1: 0
2: 7
3: 17
4: 261
1185095631_1185095643 15 Left 1185095631 22:48804589-48804611 CCAGGGCGATAGTCCCCCCTTTG 0: 1
1: 0
2: 0
3: 3
4: 37
Right 1185095643 22:48804627-48804649 TGTCCTGGAGGACCACAGGCTGG 0: 1
1: 0
2: 7
3: 17
4: 261
1185095634_1185095643 2 Left 1185095634 22:48804602-48804624 CCCCCCTTTGGCCTAGGCTGACG 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1185095643 22:48804627-48804649 TGTCCTGGAGGACCACAGGCTGG 0: 1
1: 0
2: 7
3: 17
4: 261
1185095640_1185095643 -9 Left 1185095640 22:48804613-48804635 CCTAGGCTGACGATTGTCCTGGA No data
Right 1185095643 22:48804627-48804649 TGTCCTGGAGGACCACAGGCTGG 0: 1
1: 0
2: 7
3: 17
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185095643 Original CRISPR TGTCCTGGAGGACCACAGGC TGG Intronic
900342908 1:2197154-2197176 TGTCCTGGAGGACCATGTGAGGG + Intronic
900395109 1:2450286-2450308 TGTGCTGGAGGCCCACGGGGAGG - Intronic
900412998 1:2521509-2521531 TCTCCCGGGGGAGCACAGGCGGG + Intronic
900502894 1:3015299-3015321 TGCCCTGGAGGAACACAGGCAGG - Intergenic
900553872 1:3270168-3270190 AGTCCTGGAGGAGGACAGTCGGG + Intronic
901146907 1:7071011-7071033 TTGCTTGGAGGCCCACAGGCTGG + Intronic
901190518 1:7407347-7407369 TGTCTTGGGGGACCACAGACAGG + Intronic
901211649 1:7529880-7529902 TGTCCTGGGAGGCCACATGCTGG + Intronic
902648827 1:17823260-17823282 TGTGTTGGAGAACCACAGACGGG + Exonic
904629310 1:31829427-31829449 TGTCCTGCTGGACCTCAGCCAGG - Intergenic
905253562 1:36665534-36665556 TCTTTTGGAGGAACACAGGCAGG + Intergenic
905766089 1:40602293-40602315 TGCCATGGAGGAACACAGGAGGG - Intergenic
907247383 1:53116749-53116771 TGTCCTGTGTGACCTCAGGCAGG - Intronic
908167752 1:61475073-61475095 AGTTCTGGAAGGCCACAGGCTGG + Intergenic
909161706 1:72159461-72159483 TGTCCTTGAAGACCACAGGGAGG - Intronic
912268525 1:108185216-108185238 TGTAATGGAGTACCACAGACTGG - Intronic
914432144 1:147628561-147628583 TGGCCAGGAGCACCTCAGGCAGG + Intergenic
914784146 1:150813168-150813190 TTACCTGGAAGACCTCAGGCTGG + Exonic
915082747 1:153363213-153363235 TTTCCTGGAGGAATTCAGGCAGG - Intergenic
915268564 1:154735585-154735607 TATCCTTGAGTAGCACAGGCTGG + Intronic
915611556 1:156997473-156997495 TGGCCTGGAGGAGGAAAGGCTGG + Intronic
917015605 1:170528335-170528357 TGCCCTGGAGAAACACAGGTTGG - Intergenic
920144467 1:203846798-203846820 TTTCCTTGAGGACCACTGCCTGG + Intronic
920500649 1:206482974-206482996 TGTCCTGGGGAACCTGAGGCAGG - Intronic
920547281 1:206828969-206828991 TGTGCATGAGGACTACAGGCAGG + Intronic
920838294 1:209532581-209532603 TGTCTTTGAGGACCACAGAAAGG - Intergenic
921066575 1:211627119-211627141 TGCCTTGGAGGATCACAGTCTGG - Intergenic
922211159 1:223487767-223487789 TGTCCTGGGAAACCACAGGGCGG + Intergenic
922727488 1:227929535-227929557 TGTCCTTACGGACCCCAGGCTGG + Intronic
923356464 1:233160802-233160824 TGTCTGGAAGGACCACAGCCAGG + Intronic
924040316 1:239978245-239978267 GTTCCTGGATGACCACAGGGAGG + Intergenic
924446156 1:244133423-244133445 TGTTCTGCAGGACCAAAGTCTGG - Intergenic
1062811255 10:467803-467825 GGTGCTGGAGGACTACAGGAGGG + Intronic
1065328757 10:24572186-24572208 TTTCCTGGGGCACCAGAGGCTGG - Intergenic
1067722105 10:48735881-48735903 TGTCCTGAAGGACCACGGCATGG + Exonic
1067962888 10:50876336-50876358 TGTCCAAGTGGAGCACAGGCTGG - Intronic
1068423173 10:56822234-56822256 TCTCCTGCAGGACACCAGGCAGG - Intergenic
1069893650 10:71667234-71667256 TGTCCCTGCAGACCACAGGCTGG - Intronic
1070669543 10:78368398-78368420 CCTCTTGGAGGACCACAGGGGGG + Intergenic
1071571857 10:86701448-86701470 TGCCCTGGGGGGCCCCAGGCTGG + Intronic
1072739631 10:97901636-97901658 TGTCCTGGAGGAAACAAGGCTGG + Exonic
1075686461 10:124368115-124368137 TCTCCCCGAGGACCACAGCCTGG + Intergenic
1075922494 10:126224841-126224863 TTTCATGGAGGATCCCAGGCAGG + Intronic
1075959527 10:126556574-126556596 TCTGCTGGAGTTCCACAGGCTGG - Intronic
1076132432 10:128022530-128022552 TGACCAGGAGGAGCACAGGGAGG - Intronic
1076214149 10:128679444-128679466 TATCATGGTGGACCAGAGGCTGG + Intergenic
1076782675 10:132732923-132732945 TGGCTCAGAGGACCACAGGCTGG + Intronic
1076830525 10:132992194-132992216 TGTCCTCGAGGCTCACAGGCAGG - Intergenic
1077418034 11:2434800-2434822 GGGCCAGGAGGACCACAGCCTGG + Intergenic
1083369552 11:62167328-62167350 TGGCCTGGAGGCCCAAAGGGCGG - Intergenic
1084676720 11:70639754-70639776 TGCCCTGCAGGCCCACAGGGTGG + Intronic
1084929957 11:72547146-72547168 CTTCCTGGAGGACAAGAGGCTGG + Intergenic
1085638219 11:78174326-78174348 TCTCCTGGAAGTCCTCAGGCAGG + Exonic
1086547625 11:88016488-88016510 CTTCCTGGGGGAACACAGGCCGG + Intergenic
1088988143 11:114928097-114928119 TGCCCTGGAGGTTCCCAGGCTGG + Intergenic
1089498529 11:118919680-118919702 GGTCTGGGAGGAACACAGGCTGG - Intronic
1089675513 11:120086037-120086059 TGCTGTGGAGGCCCACAGGCAGG - Intergenic
1090434255 11:126673675-126673697 TGTCCTGGAGCAGGACAGGGAGG + Intronic
1090840314 11:130481880-130481902 TGGCCTGGACGACCACAGCCTGG + Intergenic
1091947455 12:4561288-4561310 TGACCTGGAGGTGCACAGTCTGG - Intergenic
1092684934 12:11032399-11032421 TTTTCTTGAGAACCACAGGCAGG + Intronic
1092689612 12:11093291-11093313 TTTTCTTGAGAACCACAGGCAGG + Intronic
1092690048 12:11098727-11098749 TTTTCTTGAGAACCACAGGCAGG + Intronic
1092692916 12:11134812-11134834 TTTACTTGAGAACCACAGGCAGG + Intronic
1095486472 12:42689839-42689861 GTTCCTGGAGGACCACACGCTGG + Intergenic
1096182249 12:49557425-49557447 TGTCCTGGCGCCCCACAGGGAGG + Exonic
1096639955 12:52986228-52986250 TCTGCTGGAGAGCCACAGGCAGG - Intergenic
1097178902 12:57159748-57159770 AGTCCGGGAGGGCCAGAGGCAGG + Intronic
1100616354 12:96234545-96234567 AGCCGTGGAGGAGCACAGGCAGG - Intronic
1101568720 12:105933957-105933979 TCTCCTGGAGGACCACACAGGGG + Intergenic
1101865871 12:108518965-108518987 CGTGCTGGAGATCCACAGGCGGG + Exonic
1102221110 12:111194993-111195015 TGTTCTGGAGACCCACATGCGGG + Intronic
1102247800 12:111366203-111366225 TGGGCTGGGGGACCCCAGGCAGG + Exonic
1102987777 12:117292426-117292448 TGGCTTGGAGGAGCTCAGGCTGG + Intronic
1103614066 12:122141213-122141235 TGTCCAGGAGGTCCTCAGTCAGG + Intronic
1103751502 12:123166695-123166717 TGTCCTGGGTGTCCAGAGGCTGG + Exonic
1105254897 13:18737849-18737871 TGTCCTAGAAGACCCCAGGTGGG - Intergenic
1105967593 13:25398695-25398717 TGTCCTTGAGGAACTCAGGAGGG + Intronic
1106753558 13:32798594-32798616 TTTCCTGGGTGACCACAGACAGG + Intergenic
1107440599 13:40424204-40424226 AGGCCTTGAGGGCCACAGGCTGG + Intergenic
1107599153 13:41994580-41994602 TGCCCTGGAGTGCAACAGGCTGG - Intergenic
1112352288 13:98646254-98646276 TTCCCTGCAGGACCACAGCCTGG - Intergenic
1113518310 13:110919933-110919955 TGTCCTGCAGTCCCGCAGGCTGG - Intergenic
1114629418 14:24149545-24149567 TACCCTGCAGGACCCCAGGCAGG - Exonic
1114636015 14:24187285-24187307 TGTCAGGAAGGGCCACAGGCAGG + Intronic
1119520606 14:75281560-75281582 AGTCCTTGAGGCCCACAGCCTGG - Exonic
1120418705 14:84254672-84254694 TCTCCTGCAGAACCAGAGGCCGG - Intergenic
1121783260 14:96636198-96636220 GGTCCTGGAGGTCCAAAGGGAGG - Intergenic
1122608523 14:102964530-102964552 TGTCCAGGAGGAGCTCAGGAAGG - Exonic
1122971970 14:105156032-105156054 GTTCCTGGAGGACCCCTGGCCGG - Intronic
1123783065 15:23645828-23645850 TGCCCAGGAGGCCCAGAGGCAGG - Exonic
1128220526 15:65965186-65965208 TGGCCAGGAGGACCACATCCTGG - Intronic
1129069990 15:72942687-72942709 TGCCATGGAGGGGCACAGGCAGG + Intergenic
1129228249 15:74182219-74182241 TGTTCTGCAGGATCACAGCCAGG + Exonic
1129243093 15:74263222-74263244 TCTCCTGGGGGAGCTCAGGCTGG + Intronic
1132631547 16:919999-920021 TGTGCTGGGGGCCGACAGGCTGG - Intronic
1135509269 16:23068478-23068500 TGTGCTGGGGGAGCGCAGGCTGG + Exonic
1136399271 16:30009138-30009160 TGTCCTCCAGCCCCACAGGCTGG + Intronic
1137600060 16:49750375-49750397 TGTCCTGGGGGATCCCAGGTGGG + Intronic
1138120434 16:54396903-54396925 TCTGCTGGAGGACGGCAGGCTGG - Intergenic
1138834124 16:60412648-60412670 TGTCCTGGAGCACTATATGCAGG - Intergenic
1140661518 16:77194327-77194349 TTCCCTAGAGGACCACAAGCTGG + Exonic
1142141153 16:88473447-88473469 TGTCCTCGAGGGCCGCAGGGCGG + Intronic
1142277754 16:89131942-89131964 CCTCCTGGAGGAGCCCAGGCTGG + Intronic
1142277781 16:89132026-89132048 CCTCCTGGAGGAGCCCAGGCTGG + Intronic
1144093734 17:11881347-11881369 TGGCCTGGAGGACCAGTTGCTGG + Exonic
1144520973 17:15951985-15952007 TGCCCTGGAGCAGCACAGCCAGG + Intronic
1144619968 17:16812254-16812276 TGTCCTGGAGGAACTCAGTCCGG - Intergenic
1144892719 17:18503450-18503472 TGTCCTGGAGGAACTCAGTCCGG + Intergenic
1145139494 17:20440837-20440859 TGTCCTGGAGGAACTCAGTCCGG - Intergenic
1146525304 17:33562540-33562562 TGTCCTGGAGGGCCACCACCAGG + Intronic
1147135560 17:38432057-38432079 CGCCCTGGGGGGCCACAGGCGGG - Intronic
1149929944 17:60741512-60741534 TGTCCTGAAGGACCACAGATAGG - Intronic
1151323477 17:73365285-73365307 CATCCTGGAGGGCTACAGGCTGG - Exonic
1151529034 17:74692553-74692575 TATCCCTGAGCACCACAGGCCGG - Intronic
1151682889 17:75631007-75631029 TGCCCTGGAGGACAACATGAAGG + Exonic
1152597655 17:81245819-81245841 TGTCCCGGGGGGCCAGAGGCCGG - Exonic
1154285552 18:13053072-13053094 TGCCCTGGAGGACCGCAAGGTGG + Exonic
1154436132 18:14342755-14342777 TGTCCTAGAAGACCCCAGGCGGG + Intergenic
1156481230 18:37437570-37437592 TGTCCTGGAGGACCAAGGTAAGG + Intronic
1157309662 18:46542827-46542849 TGTCTTGGAGGACTTCAGGAGGG + Exonic
1157820056 18:50760583-50760605 AGTCCTGGAGGACCTCTGGTTGG - Intergenic
1159946350 18:74447130-74447152 TGGACTTGAGGACCACGGGCCGG + Exonic
1160183421 18:76655671-76655693 GGTCCTGGAGGACCAGGAGCAGG - Intergenic
1160492852 18:79352317-79352339 TGGGCAGGAGGAGCACAGGCAGG + Intronic
1161370690 19:3909331-3909353 TGTCCTGGCGGACTGCAGGGTGG - Intronic
1162835996 19:13318413-13318435 TGGCCTGGTGGACCACAAGGAGG + Intronic
1163609458 19:18293357-18293379 TGGCCTGGAGGCACCCAGGCAGG + Intergenic
1165062662 19:33212442-33212464 TGTCCTGGAGGCCCAGAAGTCGG + Exonic
1166375498 19:42324858-42324880 AGTCCTGGAGAGTCACAGGCAGG - Exonic
1166633209 19:44426014-44426036 TATCCTGGAGGAACACATGATGG + Intronic
1166930528 19:46298782-46298804 TGTCCTGAGAGACCAGAGGCAGG - Intronic
1167093086 19:47358096-47358118 TGTCCTGGTCGGCCACAGACAGG - Exonic
1167696257 19:51017138-51017160 TGTCCTGGTGGACCAGAGTTGGG - Exonic
1167736960 19:51300683-51300705 AGTCCTGGAGGAACAAAGGGAGG + Intergenic
1168205565 19:54848070-54848092 TGTCCACGAGCACCACAGTCAGG + Intronic
925178834 2:1803651-1803673 TGTCCTGGGGGACCACCCTCAGG + Intronic
925276137 2:2649639-2649661 TGCCCTGGACAACCAGAGGCCGG - Intergenic
925328008 2:3037657-3037679 GGACCTGGAGAACAACAGGCAGG - Intergenic
926734843 2:16065491-16065513 TGGCATGGAGGAGCCCAGGCTGG - Intergenic
927476692 2:23419352-23419374 TGTCCTGGCGCTCCCCAGGCTGG + Intronic
927509792 2:23637223-23637245 AGTCCTGGAGGCTCAGAGGCAGG - Intronic
927517346 2:23680086-23680108 TGGCCTGGAGGGGGACAGGCTGG + Intronic
927832051 2:26359950-26359972 ACTGCTTGAGGACCACAGGCTGG - Intronic
928224755 2:29438971-29438993 TGGCTTGGAGTCCCACAGGCAGG - Intronic
929187203 2:39107900-39107922 TGTCCTTGATAATCACAGGCAGG - Intronic
930090326 2:47527184-47527206 AGTCCTCCAGGACCACAGCCAGG + Intronic
930503478 2:52253807-52253829 TGCCCTGGAGGAACACAAGTAGG - Intergenic
932886707 2:75555243-75555265 TGACCTGCTGGATCACAGGCTGG + Intronic
934514500 2:94977767-94977789 TGTCCTGCAGGAGAACAGGAGGG - Intergenic
934721094 2:96577377-96577399 TGTCCTGGAGGATCTAAGCCAGG - Intergenic
935930384 2:108117862-108117884 TGGCCTGGAGAGCCACTGGCAGG + Intergenic
937261918 2:120591925-120591947 TAGCCTGCAGGACGACAGGCTGG - Intergenic
937620209 2:123976652-123976674 TGTCCTGGAGAAACAAAGGGAGG + Intergenic
938711111 2:133977072-133977094 TCTCAATGAGGACCACAGGCAGG + Intergenic
941367104 2:164621797-164621819 TTGCCGGGAGGACCGCAGGCGGG + Exonic
941655463 2:168139147-168139169 AGTCCTAGAGGACGTCAGGCTGG + Intronic
945992040 2:216404188-216404210 TGTCCCTGAGGACCACAAGGGGG - Intergenic
946068335 2:217009354-217009376 TGTCCTGGAGGCCTAGGGGCAGG + Intergenic
946139034 2:217672549-217672571 TGTGCTGGAAGACCAAAGTCAGG + Intronic
946308596 2:218870556-218870578 GGTCCTAGTGGACCACAAGCTGG - Intronic
948161426 2:235827956-235827978 AGTCCTGGAGTCCCGCAGGCTGG - Intronic
1168898728 20:1341949-1341971 TGTCCTTTGGGACCACAGCCCGG - Intronic
1169358109 20:4924688-4924710 TGCCCTTGAGGCCCACATGCAGG + Intronic
1174209521 20:48866460-48866482 TGTCCAGGTGAGCCACAGGCAGG + Intergenic
1174504465 20:51008252-51008274 TGCCATGTAGGACCGCAGGCTGG + Intronic
1175010574 20:55730420-55730442 TGTTCTGTAGGTCCAGAGGCAGG + Intergenic
1175287301 20:57845385-57845407 TGGCCTGGTTGACCATAGGCTGG + Intergenic
1175583974 20:60122699-60122721 GGACCTGGAGGAGCAGAGGCTGG - Intergenic
1176075274 20:63245444-63245466 TGGCCTGCAGGTCCCCAGGCAGG - Intronic
1176840906 21:13842881-13842903 TGTTCTAGAAGACCCCAGGCGGG - Intergenic
1179138561 21:38701703-38701725 TTTCCTGCAGGACCACATCCAGG + Intergenic
1179469885 21:41603468-41603490 TGTCTTGGAGCACCACAGGCTGG + Intergenic
1180127580 21:45802729-45802751 TGTCCCCAAGGACCCCAGGCAGG + Intronic
1180183247 21:46127251-46127273 CGACCTGGAGGACCACAGGGAGG + Intronic
1180376215 22:12096434-12096456 TGTCCTGCAGGAGCAGAAGCAGG - Intergenic
1180797102 22:18611341-18611363 AGTGCTGGAGAACCAGAGGCGGG - Exonic
1181224621 22:21383930-21383952 AGTGCTGGAGAACCAGAGGCGGG + Exonic
1181254011 22:21550883-21550905 AGTGCTGGAGAACCAGAGGCGGG - Exonic
1183141692 22:35947479-35947501 TGTGCTGGAAGACCTCAGGAAGG - Intronic
1184101036 22:42341899-42341921 AGTCTGGGAGGACCACAGGGAGG + Intronic
1184198912 22:42951568-42951590 TGTCCTGGAGGAGCCCAACCGGG - Intronic
1184273754 22:43399025-43399047 TGTCCTGGAGGAGCCCAGGCCGG + Intergenic
1184654540 22:45934485-45934507 TGTCCTCAAGGTCCACCGGCTGG - Intronic
1185029184 22:48432661-48432683 TGTCCTGCAGGGGAACAGGCAGG + Intergenic
1185044638 22:48522900-48522922 TGTCCTGGGGGACTAGAGGGTGG + Intronic
1185090866 22:48772396-48772418 TGTCCCAGAGGAACGCAGGCAGG + Intronic
1185095643 22:48804627-48804649 TGTCCTGGAGGACCACAGGCTGG + Intronic
1185228511 22:49667533-49667555 TGTCCTGCAGGACCCCAGGCTGG - Intergenic
950536582 3:13582416-13582438 GGTCCTAGAGGCCCACAGCCTGG - Intronic
953026560 3:39148504-39148526 GGTCCTGGGGGATCTCAGGCTGG - Intronic
954157502 3:48694714-48694736 TTTCCTGGAGGACAAAAAGCAGG + Intronic
954289534 3:49642436-49642458 GGCCCAGGAGGACCACAGCCTGG + Exonic
954625029 3:52017799-52017821 TGACTTGGAGGAGCAGAGGCTGG - Intergenic
960342209 3:116487231-116487253 TGTCCATGAGGACCAGAGGCTGG + Intronic
961752672 3:129106444-129106466 TTCCCTGGAGGACCACAGCATGG - Intronic
962235302 3:133701782-133701804 TCTCCTGGAGGGTGACAGGCAGG + Intergenic
964473013 3:157074103-157074125 TGTCCTGCAGGAACACAATCTGG - Intergenic
967598561 3:191357104-191357126 TGTCCTGGAGGACCACACCCTGG + Exonic
967893326 3:194378752-194378774 TGTCCTGAAGCACCAAAGGAGGG + Intergenic
968292101 3:197546886-197546908 TGCCCTGGGGCACCACAGGTGGG - Intronic
968622588 4:1610549-1610571 GGGCCTGGAGGACAACAGGGAGG + Intergenic
970479682 4:16460356-16460378 TGTCCCTGAGCTCCACAGGCAGG - Intergenic
974736143 4:65935620-65935642 TGTGCTAGAGCAGCACAGGCTGG - Intergenic
975992110 4:80267956-80267978 TGTTCTTGGGGACCAAAGGCTGG - Intronic
976758538 4:88523793-88523815 TTTCCTGGAGGACCAGGGGGCGG - Exonic
978203987 4:106057624-106057646 TGTTGGGGAGGACCACAGTCAGG - Intronic
981578405 4:146228433-146228455 GTCCCTGGAGGTCCACAGGCTGG + Exonic
985779536 5:1862944-1862966 ACTCCTGGAGGCCCAAAGGCAGG - Intergenic
985909688 5:2869199-2869221 TGGCCGGGAGGACCACAGTCTGG + Intergenic
985940863 5:3134525-3134547 TTTCCTGCTGGACCAGAGGCTGG + Intergenic
986029468 5:3881456-3881478 AGTCCTGCAGGAGCTCAGGCAGG - Intergenic
986972147 5:13349382-13349404 TCTCCTGGAGCAACACAGCCTGG - Intergenic
987060430 5:14238004-14238026 TGTTCTGGTGGATAACAGGCAGG - Intronic
988473152 5:31559251-31559273 TGTCCTGTAGGAACGCAAGCTGG - Intergenic
990983822 5:61624114-61624136 TGGCCTTGAGGGCCACAGGTTGG - Intergenic
992199429 5:74369109-74369131 TCTGCTGGAGGAACACATGCAGG + Intergenic
993164670 5:84337074-84337096 TGTGTTGGTGGAGCACAGGCTGG - Intronic
997294740 5:132762364-132762386 TGTCCTGGAGAAGCTAAGGCTGG + Intronic
997409616 5:133681116-133681138 TCTCCTGGAGGCGGACAGGCAGG + Intergenic
997697507 5:135873139-135873161 GCTCCTGGAGGACCAAGGGCAGG + Intronic
999461601 5:151761459-151761481 TGTCCTGCAGAGCCACATGCTGG + Intronic
999772536 5:154786429-154786451 TGTCCCAGAGGACCATAGCCAGG - Intronic
999778578 5:154830536-154830558 TGCCATGGGGCACCACAGGCAGG + Intronic
1000029429 5:157389464-157389486 TGACTTGCAGGAGCACAGGCAGG - Intronic
1001411543 5:171515753-171515775 AGTCCGCAAGGACCACAGGCTGG - Intergenic
1006405270 6:33841448-33841470 GCTCCTGGAGGACCCCGGGCTGG + Intergenic
1009603150 6:65829742-65829764 TGTAATGGAGGACACCAGGCAGG - Intergenic
1010338836 6:74723576-74723598 TCTCTTGGAAGACCACAGGCAGG + Intergenic
1014206794 6:118665012-118665034 GTTTCTGGAGGAGCACAGGCAGG - Intronic
1015886584 6:137924323-137924345 TGTCCTGGGCGTTCACAGGCGGG - Intergenic
1017507383 6:155081011-155081033 TTTCCTGGAGGTCCACAGTGAGG + Intronic
1018088907 6:160329006-160329028 TGTCCTGGCAGACCCCAGACTGG + Intergenic
1018344490 6:162886779-162886801 TTTCCTGGAGGAAAACATGCAGG + Intronic
1018435322 6:163753816-163753838 TGTCATGAAGAACCACAGACTGG + Intergenic
1018469538 6:164083399-164083421 TGTCCAAGAGGACCACCTGCCGG + Intergenic
1019388416 7:771567-771589 TTTCCTGCAGTACGACAGGCGGG - Intronic
1021786548 7:24158135-24158157 TGACATGGAGGACAAAAGGCTGG + Intergenic
1022196240 7:28069919-28069941 TGACCTTGAGGCCCACAGACTGG + Intronic
1024005256 7:45220478-45220500 TGACCTGGAAGGCCACATGCTGG + Intergenic
1024123739 7:46270832-46270854 TCTCCTAGAGGACCACAGCTGGG - Intergenic
1024983875 7:55179545-55179567 TGGGCAGGAGGACCAGAGGCTGG + Intronic
1026119427 7:67523935-67523957 TGTCCTGAAGGAGCTGAGGCTGG - Intergenic
1033601563 7:142892420-142892442 TGGCCAGAAGGACCAGAGGCTGG - Intergenic
1034353436 7:150432295-150432317 TGTCATGGAGAAACACAGTCTGG + Intergenic
1034788192 7:153944411-153944433 TGTTCTGGAGGACACCAGGAGGG + Intronic
1035232907 7:157477032-157477054 GGTTCCGGATGACCACAGGCTGG + Intergenic
1035232912 7:157477053-157477075 GGTTCCGGATGACCACAGGCTGG + Intergenic
1035417487 7:158702528-158702550 TTTCCTGGAAAAACACAGGCAGG - Intronic
1036800251 8:11785845-11785867 TGTCCTGGGGGACCCTAGACGGG - Intronic
1037584622 8:20268199-20268221 CCTCCTGGAGGCCCAGAGGCAGG - Intronic
1038383665 8:27120642-27120664 TGACCTGGGGGTCCCCAGGCTGG - Intergenic
1040652756 8:49467200-49467222 TGTCCTGGAGGTCCTCATCCTGG - Intergenic
1041703261 8:60815717-60815739 AATCCTGGAGGAACACAGTCTGG + Intronic
1044837140 8:96307013-96307035 TGTCCTGGAGGACTACAGGAAGG - Intronic
1045354454 8:101373107-101373129 TGACATGGAGGAGCCCAGGCTGG - Intergenic
1047349527 8:124060427-124060449 TTTCCTGGAGGAACACAGCGTGG + Intronic
1048407478 8:134138122-134138144 TGCCCTGGACGAGCACAGGCTGG + Intergenic
1048567623 8:135619797-135619819 TATCCTGGAGAAGCACATGCAGG - Intronic
1049256374 8:141616054-141616076 GTTCCTGGATGACCACAGGGAGG + Intergenic
1050456423 9:5839130-5839152 TGTGCTTGAGGAATACAGGCTGG - Intergenic
1051991789 9:23161202-23161224 TGTCCTTGATGGCCACAGCCTGG - Intergenic
1053191736 9:36076908-36076930 TGTCATGGAAGAGCACTGGCAGG + Intronic
1053203817 9:36170267-36170289 TGTCCTGATGGACCGCAAGCAGG + Exonic
1056756555 9:89385483-89385505 TGTCCTGGAGACCGAGAGGCTGG + Intronic
1057796378 9:98160904-98160926 AGTCCTAGAGGGTCACAGGCAGG - Intronic
1058357809 9:104104866-104104888 TGCCCAGGAGGACCACAGGCAGG + Intronic
1059757394 9:117306398-117306420 TGTCCTTGAGGTCAAGAGGCTGG - Intronic
1060003276 9:119977756-119977778 AGTTCTGGAGGATCACATGCTGG + Intergenic
1060196291 9:121625708-121625730 CTTCCTGGGGCACCACAGGCAGG + Intronic
1060588727 9:124802680-124802702 GGTCGAGGAGGACCACAGGGAGG - Intronic
1061452405 9:130675420-130675442 TGTCCAGCAAGAGCACAGGCTGG - Intronic
1062113585 9:134795929-134795951 TGTCCTGGAGGAGTTCAGGGTGG - Intronic
1062349932 9:136133543-136133565 TTTCTTGCAGGAGCACAGGCGGG + Intergenic
1062670695 9:137707245-137707267 GGTGCTGAAGCACCACAGGCTGG - Intronic
1202800879 9_KI270719v1_random:174663-174685 TGGCCTGGGGGCCCTCAGGCTGG + Intergenic
1203538603 Un_KI270743v1:66738-66760 TGTCCTGCAGGAGCAGAAGCAGG - Intergenic
1188114065 X:26222753-26222775 AGCCTTGGAAGACCACAGGCAGG + Intergenic
1189368902 X:40412326-40412348 TTGCCTTGAGGACCCCAGGCTGG + Intergenic
1190598991 X:52070280-52070302 TGTCCTGGCGGACACCAGGAGGG - Intergenic
1190609833 X:52183793-52183815 TGTCCTGGCGGACACCAGGAGGG + Intergenic
1196299439 X:114037556-114037578 TGTCCGGTAGGACCACTGGCTGG - Intergenic
1196711657 X:118769797-118769819 TGACCTGGAGCACCACAGCCGGG + Intronic
1199076785 X:143534536-143534558 AGTCCTGGAGCACCACACACTGG + Intergenic
1199746018 X:150772346-150772368 GGCGCTGTAGGACCACAGGCTGG + Intronic
1200963143 Y:9013220-9013242 TATCCTGTTGGAACACAGGCAGG + Intergenic