ID: 1185095749

View in Genome Browser
Species Human (GRCh38)
Location 22:48805092-48805114
Sequence GGCCTCCTGGACCACGGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 5, 3: 24, 4: 248}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185095736_1185095749 28 Left 1185095736 22:48805041-48805063 CCAAGTACATGCAGCTCTCCAGC 0: 1
1: 0
2: 0
3: 21
4: 531
Right 1185095749 22:48805092-48805114 GGCCTCCTGGACCACGGTGCTGG 0: 1
1: 0
2: 5
3: 24
4: 248
1185095742_1185095749 6 Left 1185095742 22:48805063-48805085 CCAGTGGATGTGGCAAGAAGGGG 0: 1
1: 0
2: 2
3: 25
4: 227
Right 1185095749 22:48805092-48805114 GGCCTCCTGGACCACGGTGCTGG 0: 1
1: 0
2: 5
3: 24
4: 248
1185095739_1185095749 10 Left 1185095739 22:48805059-48805081 CCAGCCAGTGGATGTGGCAAGAA No data
Right 1185095749 22:48805092-48805114 GGCCTCCTGGACCACGGTGCTGG 0: 1
1: 0
2: 5
3: 24
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185095749 Original CRISPR GGCCTCCTGGACCACGGTGC TGG Intronic
900269170 1:1778413-1778435 GGCCGCCCGGACCCCGGCGCCGG + Intronic
900409183 1:2505107-2505129 GCCCTCGTGGCCCACGGAGCAGG - Exonic
901058914 1:6462705-6462727 AGCCTCCTGGACCTGGGTGCTGG + Intronic
902368124 1:15990450-15990472 GGCCTCCTGGGCCAGGGTGCTGG - Intergenic
902864418 1:19268990-19269012 GGCCTCCTGGACCTCCTTCCAGG + Intergenic
902932403 1:19740799-19740821 GGCCTCCTGGGCCACCATGTTGG + Exonic
904365817 1:30010381-30010403 GGCCTCCTGCTCCACGGAGCAGG - Intergenic
904438067 1:30512299-30512321 GGCCTCTGGGACCACAGAGCAGG - Intergenic
904675802 1:32198674-32198696 GGCCTTCTGAACCACAGGGCAGG + Intergenic
905110272 1:35589706-35589728 GGGCTCCTGGAGCTGGGTGCTGG + Intronic
906082541 1:43102637-43102659 GGCCTCCTGCTCCATGGAGCAGG - Intergenic
908120028 1:60977433-60977455 GGCCTGATGGACCACGGCACTGG + Intronic
909043886 1:70686314-70686336 GGCCTCCTGGATTCAGGTGCTGG + Intergenic
912308619 1:108596518-108596540 GGCGTCCTGGACCACAGAGAAGG + Intronic
913317735 1:117566709-117566731 GACCTCCAGGACCTCGGGGCTGG + Intergenic
913666849 1:121056739-121056761 GCCCTCCTGGACCATGGTAAGGG - Intergenic
914018593 1:143844175-143844197 GCCCTCCTGGACCATGGTAAGGG - Intergenic
914657148 1:149752378-149752400 GCCCTCCTGGACCATGGTAAGGG - Intergenic
915111254 1:153565805-153565827 GGCATCCTGGACCGGGGTGAGGG + Exonic
915185219 1:154099242-154099264 GGCCTCCTGCTCCACCGAGCAGG - Intronic
916854741 1:168738036-168738058 AGCCTCCTAGAACACAGTGCAGG - Intergenic
917444813 1:175098387-175098409 GGTCTCCTGGGACCCGGTGCAGG + Exonic
917803045 1:178587494-178587516 TGCCTCCTGGCCCACAGTGATGG - Intergenic
919083375 1:192891979-192892001 GGCCTCCTGCTCCACAGAGCAGG - Intergenic
920559680 1:206930342-206930364 GGCCTCGGCGGCCACGGTGCTGG + Exonic
922132631 1:222795003-222795025 GGCCTCCTGCTCCATGGAGCAGG + Intergenic
924707916 1:246513260-246513282 GGCCTCCTGGGCCAGGGTGCCGG + Intergenic
1063382235 10:5592697-5592719 GCCCTTCAGGGCCACGGTGCAGG + Intergenic
1064167696 10:13001217-13001239 GTAGTCCTGGACCACGGTGTGGG + Exonic
1064521614 10:16209102-16209124 GGCCTCCTGGAACTCGGGGTGGG + Intergenic
1064797093 10:19024687-19024709 AGCCTCCTGGGTCACGGTTCAGG + Intergenic
1067508062 10:46873171-46873193 GGCCACGTTGACCATGGTGCAGG + Intergenic
1067654189 10:48178674-48178696 GGCCACGTTGACCATGGTGCAGG - Intronic
1068967177 10:62924470-62924492 GGCCTCCGGCTCCACGGAGCAGG - Intergenic
1068967221 10:62924645-62924667 GGCCTCCTGCTCTACGGAGCAGG - Intergenic
1072154827 10:92714941-92714963 GGCCTCCTGCTCCACAGAGCAGG - Intergenic
1072404998 10:95142800-95142822 GGCCTCTTGGAGCAGGGAGCTGG + Intergenic
1072536471 10:96368106-96368128 GGCATCCTGGAACTTGGTGCTGG + Exonic
1072574107 10:96684530-96684552 GGCAGCCTGGACCATGCTGCAGG + Intronic
1072962530 10:99941868-99941890 GCCATCCTGGTCCAAGGTGCTGG + Intronic
1073425300 10:103452214-103452236 GGCCTCCAGGAGGGCGGTGCAGG + Exonic
1074028652 10:109663258-109663280 GGCCTCCTGCTCCACGGGGTAGG + Intergenic
1074291416 10:112140384-112140406 CCCCGCCTGGACCAGGGTGCAGG - Intergenic
1075526677 10:123192753-123192775 GGCCTCCTGAGCCATGGTGAAGG - Intergenic
1076164747 10:128272722-128272744 GCCCTCAGGGACCACGCTGCAGG + Intergenic
1076627810 10:131832597-131832619 GGCCTGCTGGTCAACGGGGCTGG - Intergenic
1076701368 10:132275014-132275036 GGCCTGCTGTGCCATGGTGCTGG - Intronic
1077338422 11:2015620-2015642 GGGCTCCGGGACCAAGGTGTGGG - Intergenic
1078616136 11:12867906-12867928 GGCCTCCTGGAGCAGGTGGCTGG + Intronic
1081867298 11:46366838-46366860 GGCCCCCAGGGCCAGGGTGCTGG - Exonic
1083442750 11:62687912-62687934 GGCCGCGTGGACCAGAGTGCGGG + Exonic
1083655196 11:64226116-64226138 TGCCTCCCGGACCACCCTGCGGG - Exonic
1084476484 11:69392298-69392320 GACCTCCTGGACCACAGGGGAGG + Intergenic
1084991030 11:72925880-72925902 GGCCTCCTGGTCTACGGAGCAGG + Intronic
1086123531 11:83326437-83326459 TGCCACCTGGGCCAAGGTGCAGG - Intergenic
1089366114 11:117922045-117922067 GGCCTGCTGCCCCACGCTGCTGG + Intronic
1202821406 11_KI270721v1_random:70802-70824 GGGCTCCGGGACCAAGGTGTGGG - Intergenic
1091563375 12:1630575-1630597 GCCCTCGAGGACCACGGTGCCGG + Intronic
1093059733 12:14589718-14589740 GGCCTCCCGCTCCACGGAGCAGG - Intergenic
1095727382 12:45469027-45469049 GGCCTCCTGCTCTACGGAGCAGG + Intergenic
1097767562 12:63543177-63543199 GGCCTCCTGGTACACGTGGCAGG - Intergenic
1103390193 12:120566915-120566937 GGCCCCATGGCCCTCGGTGCTGG - Exonic
1103934077 12:124466133-124466155 GGCCTGCTGCCCCCCGGTGCTGG - Intronic
1104573363 12:129944836-129944858 GGTGTCCTGGACCAGGGTGGTGG - Intergenic
1106173332 13:27307863-27307885 GCCATCCTGGACCACGATGGTGG - Intergenic
1106246361 13:27953824-27953846 GGCCTCCTGGCCAAGGGCGCTGG - Intergenic
1111800571 13:92975130-92975152 GGCCTCCTGCTCCTCGGAGCAGG - Intergenic
1112365536 13:98752512-98752534 CGCCTCCCGGCCCTCGGTGCCGG + Intronic
1112621602 13:101058975-101058997 GGCCTCCTGGAGCACCCTGCTGG + Intronic
1113670246 13:112171169-112171191 GGCCTCCTGCACCTATGTGCTGG - Intergenic
1113697199 13:112354872-112354894 GAGCTCCTGCACCACGGTGCTGG - Intergenic
1113893960 13:113751956-113751978 CGCCTCCTCGGCCACGGAGCCGG - Intergenic
1113893970 13:113751996-113752018 CGCCTCCTCGGCCACGGAGCCGG - Intergenic
1113893980 13:113752036-113752058 CGCCTCCTCGGCCACGGAGCCGG - Intergenic
1113893990 13:113752076-113752098 CGCCTCCTCGGCCACGGAGCCGG - Intergenic
1113894000 13:113752116-113752138 CGCCTCCTCGGCCACGGAGCCGG - Intergenic
1113894037 13:113752276-113752298 CGCCTCCTCGGCCACGGAGCCGG - Intergenic
1115973731 14:38974059-38974081 GGCCTAGTGGATCAGGGTGCAGG - Intergenic
1117828531 14:59727475-59727497 GGCCTCGTGGTCCAGGGGGCTGG + Exonic
1118213670 14:63788380-63788402 GGCCTCCTGCTCCAAGGAGCCGG - Intergenic
1118213713 14:63788558-63788580 GGCCTCCTGCTCCATGGAGCAGG - Intergenic
1118316131 14:64727224-64727246 GGGTACCTGGACCACTGTGCTGG + Intronic
1121297673 14:92842813-92842835 GGCCTCTTGCACCAGGGAGCTGG - Intergenic
1121315379 14:92958232-92958254 GGGCCTCTGGACCACGGTGTAGG + Exonic
1122138415 14:99647656-99647678 GGCCTCCTGGAGCATGCTGGCGG + Intronic
1122860966 14:104582210-104582232 GGCGTCCTGGAGGACGGGGCAGG + Intronic
1122953964 14:105061343-105061365 GCCTTCCTGGACCAGGGTCCGGG + Intronic
1123059252 14:105587042-105587064 GGCCTCGTGGCCCACCATGCAGG + Intergenic
1123068358 14:105629221-105629243 GGCCTCCAGGACGACCGGGCTGG - Intergenic
1123083583 14:105707273-105707295 GGCCTCGTGGCCCACCATGCAGG + Intergenic
1123092377 14:105747545-105747567 GGCCTCCAGGACGACCGGGCTGG - Intergenic
1123097955 14:105775246-105775268 GGCCTCCAGGACGACCGGGCTGG - Intergenic
1126134562 15:45378093-45378115 GGCCTGCTGGCCCACGGCGCAGG - Intronic
1128312368 15:66639164-66639186 GGCTTCCTGGAAAATGGTGCAGG - Intronic
1128562504 15:68678000-68678022 AGCCTCCTGGGCCAGGGGGCTGG - Intronic
1132226168 15:100143106-100143128 AGCCTCCAGGACCAGGGTGGTGG + Intronic
1132549730 16:549399-549421 CGGCACGTGGACCACGGTGCTGG + Exonic
1132695579 16:1200393-1200415 GGCCTCCCAGCCCAGGGTGCAGG - Exonic
1133025475 16:2987331-2987353 GGCCTTCTGGACCAGGGTGCAGG + Intergenic
1137003892 16:35255150-35255172 CGCCTCCTGGACCACTGTCGCGG - Intergenic
1137238408 16:46633912-46633934 GGCCTCCTGCTCTACGGAGCAGG - Intergenic
1137293002 16:47064982-47065004 GGCCTCCTGGTGGAAGGTGCTGG + Intergenic
1137334462 16:47533912-47533934 GGCCTCCTGCTCCACAGAGCAGG - Intronic
1137963855 16:52911832-52911854 GGCCTCATTGACCATGGTGCTGG - Intergenic
1138099965 16:54244520-54244542 AGCCTCCTGGGCCACGGAGCAGG + Intergenic
1140506919 16:75479337-75479359 GGCCTCCCGGGCCAGGGTGAAGG + Exonic
1141700962 16:85641846-85641868 GGCCTCCTGGGCCAAGGGGCTGG + Intronic
1142033832 16:87851791-87851813 GGCATCCTGGACCCGGGTGGCGG + Exonic
1142213207 16:88818097-88818119 GGCCTCCTGGTACTCGGCGCTGG + Exonic
1144714386 17:17424098-17424120 GGCCTCCCGGGCCATGGAGCAGG + Intergenic
1145760929 17:27425252-27425274 GGCCTCCTGGGCCAGGGTGCCGG - Intergenic
1145779296 17:27551782-27551804 TGCCTCCAGCACCACGGTCCAGG + Intronic
1145991245 17:29080639-29080661 GGCCTCCTCGGCCACGCGGCGGG - Intronic
1146160969 17:30559409-30559431 GGCCTCCTGGGCCAGGGTGCCGG - Exonic
1147336654 17:39730362-39730384 GGCCCGCGGGACCAGGGTGCGGG + Intronic
1147419551 17:40315581-40315603 GCCCTCCAAGACCATGGTGCGGG - Intronic
1150742288 17:67789078-67789100 AGCCTCCAGGCCCACGATGCTGG + Intergenic
1151185002 17:72357414-72357436 AGCCTCCTGGAGCACAGAGCAGG + Intergenic
1151422874 17:74009885-74009907 AGCCTCCTGGACACCAGTGCTGG - Intergenic
1152563755 17:81091128-81091150 GGCCTCCTGCACCAAGGGGTGGG - Intronic
1152586026 17:81189875-81189897 GCCCTGCTGGACCTCGGGGCTGG - Intronic
1152594568 17:81232084-81232106 GGCCTCCTGGTCCAGGGCCCCGG - Intronic
1152785839 17:82247545-82247567 GGGCTCCTGTACCATGGTTCAGG + Intronic
1155192019 18:23438631-23438653 GTCCTCCTGGCTCTCGGTGCTGG + Intergenic
1156298935 18:35818278-35818300 GGCCTCCTGCAACACGGAGTGGG - Intergenic
1157431102 18:47627278-47627300 TGCCTGCTGGACCATGGTCCTGG - Intergenic
1158984946 18:62804460-62804482 GGCCTCCCAGCCCAAGGTGCTGG - Intronic
1159519178 18:69496080-69496102 GGCCTCCTAGCCCACAGAGCAGG - Intronic
1160785086 19:896598-896620 GTCCTCCTGGCCCAGGCTGCAGG - Exonic
1160833486 19:1113840-1113862 GCAGTCCTGGGCCACGGTGCCGG - Intronic
1161594208 19:5142911-5142933 GGCCGCCAGGGCCCCGGTGCTGG + Intronic
1161731560 19:5964055-5964077 GGCATCCGGGCCCACGGTGCTGG + Intronic
1161915604 19:7225755-7225777 GGACCCCTGGACCAGGGTGCTGG - Intronic
1162453203 19:10766936-10766958 GCCCTCCTGGCTCAGGGTGCCGG + Intronic
1162717390 19:12642645-12642667 GGTCTCCTGGAACACTGTCCTGG + Intergenic
1163277727 19:16296009-16296031 GGCCTCCTGGTCCAGAGTGGCGG - Intergenic
1165461119 19:35944955-35944977 GTCCAGCTGGACCACGGTGTGGG - Exonic
1166898062 19:46036406-46036428 GGCCTCCTGCTCCATGGAGCAGG + Intergenic
1167144735 19:47675006-47675028 GGCAGCCTGGGCCATGGTGCAGG + Intronic
1168076408 19:53982779-53982801 GGCCTCCTTGGCCAGGGTCCCGG - Exonic
924985146 2:264046-264068 GGCCTCCTTGTCCGCGGGGCGGG - Exonic
925048078 2:789689-789711 GGCCTCCTGCTCCACAGAGCAGG + Intergenic
925336485 2:3102492-3102514 GGCCTTCTGGGTCACAGTGCTGG + Intergenic
929441202 2:41966923-41966945 GGCCTCCTGGCCCTCACTGCAGG + Intergenic
931069254 2:58626022-58626044 GTCCACCTGGACCACGAAGCAGG - Intergenic
932501719 2:72188075-72188097 GGCCTCCTGCTCCATGGAGCAGG - Intronic
932585956 2:73029057-73029079 GGCCTCCTGGGACCGGGTGCTGG + Intronic
934503192 2:94874494-94874516 GGCCTCCGGGGCAGCGGTGCTGG + Intronic
935518867 2:104078815-104078837 GGCCTCCAGCACCACAGAGCAGG - Intergenic
936251659 2:110872652-110872674 AGCCTCCTGGAGCTGGGTGCAGG - Intronic
936290266 2:111217431-111217453 GGCCTCCTGCTCCATGGAGCAGG - Intergenic
936674806 2:114702581-114702603 GGCCTCATGGACCAGGGAGAAGG - Intronic
942081911 2:172408281-172408303 GGCATCCAGGACCACAATGCAGG + Intergenic
946616671 2:221517538-221517560 GGCCACCTGGACCAGGGTGGAGG + Intronic
946921352 2:224584907-224584929 GGCGTCCGGGACCCCGGGGCCGG - Intronic
947995325 2:234522661-234522683 AGCCTCCTGGACCACAGAGCTGG + Intergenic
948476197 2:238221379-238221401 GGCCTCCCGCTCCACGGAGCAGG - Intergenic
948831906 2:240602417-240602439 GCCCTCCTGGACCCCTCTGCCGG + Intronic
1169162976 20:3398126-3398148 GGCCTCCAGGATCACCATGCAGG + Intronic
1169303423 20:4466696-4466718 GGCCTCCTGGAAGAAGATGCAGG - Intergenic
1169423235 20:5475899-5475921 AGACTCCTGGACCACAGTGCAGG + Intergenic
1169424635 20:5486229-5486251 AGTTTCCTGGACCACAGTGCAGG + Intergenic
1173316670 20:41950884-41950906 GGCCTTGTGGACCACTGTGAAGG + Intergenic
1174668987 20:52288364-52288386 GGCAGCCTGGACCAAGGTGGTGG + Intergenic
1175424170 20:58853808-58853830 GGCCTCCTGGAGCAAGGTCTGGG - Exonic
1175873673 20:62219859-62219881 GGCAGCCTGGACCGCGGTGCTGG - Exonic
1176287019 21:5023659-5023681 GGCTTCCTGGGCCAGGGTGGGGG - Intronic
1177396178 21:20538444-20538466 GGCCTCCTGCTCCACAGAGCAGG - Intergenic
1178841554 21:36141695-36141717 GGCCACCTGGACCTCAGTGGAGG + Intronic
1179870162 21:44239816-44239838 GGCTTCCTGGGCCAGGGTGGGGG + Intronic
1180854440 22:19037210-19037232 GGCCTGCTGGAGCATGATGCTGG - Exonic
1180971287 22:19817079-19817101 GGTCTCTCGGACCTCGGTGCAGG + Intronic
1181050296 22:20235179-20235201 GGCCTCCTGTTCCCCGGTGTTGG + Intergenic
1183316687 22:37141034-37141056 GGTCTCCTGCTCCACGGAGCAGG + Intronic
1183466582 22:37983263-37983285 GGCCTCCTGCACCTCAGAGCGGG - Intronic
1183875248 22:40774956-40774978 GGTGGCCTGGACCACGGTGGTGG - Intronic
1184239098 22:43202492-43202514 GGCCTCCTGGACCTCGGCATGGG + Exonic
1184379742 22:44137871-44137893 GTCATCCTGGATCAAGGTGCAGG + Intronic
1184561019 22:45262981-45263003 GGCCTCCCGCTCCACGGAGCAGG - Intergenic
1184638202 22:45852792-45852814 GGCCTCCTGGACCACTCAGGTGG - Intergenic
1185095749 22:48805092-48805114 GGCCTCCTGGACCACGGTGCTGG + Intronic
1185097677 22:48820654-48820676 GGCTGCCTGCACCACGGTGGGGG + Intronic
1185268858 22:49919057-49919079 GGACTCCAGGACCACGGTGGAGG - Intronic
951136342 3:19107817-19107839 GGCCTCCTGCTCCAAGGAGCAGG - Intergenic
952269481 3:31817496-31817518 GGCCTCCTGCTCCACGGAGCAGG - Intronic
953454108 3:43028782-43028804 GGCCTCCAGGGCCACAGGGCAGG - Intronic
956701442 3:71962727-71962749 TGCCTCCTGGGCCACAGAGCAGG - Intergenic
956716855 3:72086999-72087021 TGAATCCTGGACCACGGGGCTGG - Intergenic
957625772 3:82650608-82650630 GGCCTCCTGCTCCACAGAGCAGG + Intergenic
962145203 3:132833308-132833330 GGCCTCCTGGACCCAGGAGGTGG + Intergenic
962786064 3:138769016-138769038 GGCCTCCTGCTCCATGGAGCAGG - Intronic
962968062 3:140372234-140372256 GGCCTCCTGATCCCCGTTGCTGG + Intronic
963483238 3:145903817-145903839 GGCCTCCTGCTCCACAGAGCAGG + Intergenic
963613609 3:147506024-147506046 GGCCTCCTAGACCACAGTTAGGG - Intronic
964255123 3:154766843-154766865 GGCCTCCTGATCCAGGGTGCAGG - Intergenic
965541978 3:169880001-169880023 GGCCTCCTGCTCCACAGAGCAGG + Intergenic
966246027 3:177808974-177808996 CGCCCCCTGCTCCACGGTGCCGG - Intergenic
968084065 3:195866844-195866866 GCCCTCCTGGGGCACGGAGCGGG + Intronic
976675591 4:87698261-87698283 GGCCTCCTGCTCCATGGAGCAGG - Intergenic
976734587 4:88296829-88296851 GGCCTCCTGTTCCAAGGAGCAGG - Intergenic
984819977 4:183873579-183873601 TTCCTCCTGGAGCACTGTGCTGG + Intronic
985127241 4:186706913-186706935 AGCCTTCTGGACCACGGAGAAGG - Exonic
985145162 4:186889054-186889076 GGCCCCGGGGCCCACGGTGCTGG + Intergenic
992747652 5:79835258-79835280 GGCCACCTGGACCAGGCTGGTGG - Intergenic
996535143 5:124570046-124570068 GGACGCCTGGACCACGGTGGAGG + Intergenic
997960298 5:138315988-138316010 GGCCTCCTGTTCCACGGAGCAGG + Intronic
998152365 5:139764668-139764690 GGCCTCCTGGCCCAGCTTGCTGG - Intergenic
998792191 5:145777716-145777738 GGCCTCCTGCTCCACGGAGCAGG + Intronic
999859777 5:155633286-155633308 GGCCTCCTGCTCTACGGAGCAGG + Intergenic
1001145499 5:169180526-169180548 GGACTGCTGGTCCACGGTGATGG + Intronic
1001680641 5:173554607-173554629 GGCCTCCTGGAAGACTGTGTTGG - Intergenic
1002282746 5:178142477-178142499 TGCCTCCTGGGCTACGGGGCTGG + Intronic
1002932399 6:1643634-1643656 GACCACCTGGGCCACGGTGGGGG + Intronic
1005212861 6:23488703-23488725 GGCCTTCTGGAGCACAGTGCTGG + Intergenic
1005801443 6:29429187-29429209 TGCCTCAGGGACCACAGTGCTGG + Intronic
1006060364 6:31414412-31414434 GGCCTCCTCGAGCAAGGTGGGGG + Intronic
1006072806 6:31509183-31509205 GGCCTCCTCGAGCAAGGTGGGGG + Intronic
1006163135 6:32049538-32049560 GGCCTCCGGGGCCTCAGTGCTGG + Intronic
1006500773 6:34457674-34457696 GGCCTCCTGCTCTACGGAGCAGG + Intergenic
1006950954 6:37820269-37820291 GGCCTCCTGGGCCACGGGTGAGG + Intronic
1007776484 6:44227076-44227098 GGCCTGCTGGGCCAGGGGGCTGG + Intronic
1010830080 6:80516439-80516461 AGCCTCCTGGAACACAGAGCAGG + Intergenic
1013375404 6:109509753-109509775 GGCCTCCTGCTCCATGGAGCAGG + Intronic
1014603940 6:123448737-123448759 GGCCTCCTGCACCAAAGTGCAGG - Intronic
1014946068 6:127499711-127499733 AGCCTCCTGGAGCACAGAGCAGG - Intronic
1015843352 6:137495321-137495343 GGCTTCCTGGACCTTGGCGCTGG + Intergenic
1016190580 6:141260691-141260713 GGCCTCCTGTTCCATGGAGCAGG + Intergenic
1016713976 6:147203652-147203674 GGCCTGCTGGGCCAGGGTGGGGG + Intergenic
1017054379 6:150424432-150424454 GGCCTCCTGCTCCATGGAGCAGG + Intergenic
1017690318 6:156957473-156957495 GGCTGCCAGGACCACCGTGCAGG + Intronic
1018627115 6:165790923-165790945 GGCCTGCTGTACAACTGTGCAGG - Intronic
1019395835 7:817057-817079 GCCCGCCTGGACCCCGTTGCGGG + Intronic
1019441667 7:1050568-1050590 GTCCGCCTGCACCAGGGTGCAGG - Intronic
1020265745 7:6558970-6558992 GGCATCTTGGACCAGGGTGGTGG - Intergenic
1021561542 7:21972617-21972639 GGCCTCCTGCTCTACGGAGCAGG - Intergenic
1022465450 7:30650127-30650149 GGCCTCCAGGATCTGGGTGCTGG + Intergenic
1024396414 7:48873990-48874012 GGCCTAATGGACAACGATGCAGG + Intergenic
1029729212 7:102428500-102428522 GGCCTCCTGGAACTCGCTCCAGG - Intergenic
1032201430 7:129825494-129825516 GGCATCCTGGAGCAGGGGGCTGG - Intergenic
1032488126 7:132303776-132303798 GGCCTCCTGGAAGGCGGGGCTGG - Intronic
1033839860 7:145360626-145360648 CACCTCCTGCTCCACGGTGCTGG - Intergenic
1034983230 7:155491432-155491454 GGCTCCCGGGACCAGGGTGCAGG + Intronic
1035856916 8:2985831-2985853 GGCCTCCTGGAGCACATTTCCGG - Intronic
1036788900 8:11704859-11704881 GGCCTCCTCGCCCTCGGGGCTGG + Intronic
1039569117 8:38572943-38572965 GGTGTCCTGGAGCACCGTGCAGG + Intergenic
1041357395 8:57014678-57014700 GGCCTCCTGCTCCACAGAGCAGG - Intergenic
1042560924 8:70071595-70071617 GGCCTTCTGGACTCCGGTTCAGG - Intronic
1044592849 8:93930777-93930799 GGCTTCCTGGTCCACAGAGCAGG - Intergenic
1049021674 8:139961442-139961464 GGCCTCCTGCTCTACGGAGCAGG + Intronic
1049056004 8:140238144-140238166 CGTCTCCTGGACCACTGAGCTGG - Intronic
1049823918 8:144654898-144654920 AGCCTCCTGCTCCACGGAGCAGG + Intergenic
1050483862 9:6114156-6114178 GGCCTCCTGCTCCACAGAGCAGG + Intergenic
1051779864 9:20678578-20678600 GGCCTCCTGCAGCACTGTGAAGG - Intronic
1053617254 9:39781287-39781309 GGCCTCCTGCTCTACGGAGCAGG + Intergenic
1053841559 9:42191892-42191914 TGCCCCCTGCACCCCGGTGCCGG - Intergenic
1053875436 9:42540650-42540672 GGCCTCCTGCTCTACGGAGCAGG + Intergenic
1054120021 9:61198286-61198308 TGCCCCCTGCACCCCGGTGCCGG - Intergenic
1054236264 9:62561074-62561096 GGCCTCCTGCTCTACGGAGCAGG - Intergenic
1054266912 9:62926150-62926172 GGCCTCCTGCTCTACGGAGCAGG - Intergenic
1054550405 9:66595604-66595626 GGCCTCCTGCTCTACGGAGCAGG - Intergenic
1054587735 9:66984276-66984298 TGCCCCCTGCACCCCGGTGCCGG + Intergenic
1055814106 9:80185312-80185334 GCCCTCCTGCTCCACGGCGCCGG - Intergenic
1056627621 9:88266529-88266551 GGCCTCCTGAACTAGGCTGCAGG - Intergenic
1056986004 9:91364244-91364266 GGCCTCCTGCTCCACAGAGCAGG + Intergenic
1060001553 9:119963458-119963480 GGGCTCCTGGGCCACGAGGCTGG + Intergenic
1061640599 9:131952083-131952105 AGCCTCCTGGGGCACAGTGCGGG - Intronic
1062346732 9:136118510-136118532 GGCGTCCCGGACCTCGGGGCCGG + Exonic
1203498201 Un_GL000224v1:173164-173186 GGACTCCGGGACCATGCTGCTGG - Intergenic
1203510755 Un_KI270741v1:115414-115436 GGACTCCGGGACCATGCTGCTGG - Intergenic
1189360046 X:40343428-40343450 GGCCTCCTGCTCTACGGAGCAGG + Intergenic
1189856479 X:45229524-45229546 GGCCTCCTGCTCCATGGAGCAGG - Intergenic
1190051979 X:47157253-47157275 GGGCCTCTGGACCACGGTGTAGG + Intronic
1190620866 X:52285309-52285331 GGCCTCCTGTTCCACAGAGCAGG - Intergenic
1192265469 X:69534335-69534357 GGCCTCCTGCTCCACAGAGCAGG - Intergenic
1194380189 X:93181448-93181470 GGCCTCCTGCCCCACAGAGCGGG + Intergenic
1200169343 X:154060988-154061010 GGACACCTGGACCAGGGTGGGGG + Intronic
1200274139 X:154716025-154716047 GGCCACCTGGAGGATGGTGCAGG - Exonic
1200398044 X:156002739-156002761 AGCGTCCTGGACCACTGTCCAGG - Intronic