ID: 1185097273

View in Genome Browser
Species Human (GRCh38)
Location 22:48817619-48817641
Sequence TTCCCAGGAAGGACCCATAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1739
Summary {0: 1, 1: 0, 2: 4, 3: 18, 4: 1716}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185097263_1185097273 18 Left 1185097263 22:48817578-48817600 CCGTAATCTCTGGCTTTGTCTGC No data
Right 1185097273 22:48817619-48817641 TTCCCAGGAAGGACCCATAGGGG 0: 1
1: 0
2: 4
3: 18
4: 1716
1185097269_1185097273 -9 Left 1185097269 22:48817605-48817627 CCTTCTGGAGCTGGTTCCCAGGA 0: 1
1: 0
2: 0
3: 13
4: 229
Right 1185097273 22:48817619-48817641 TTCCCAGGAAGGACCCATAGGGG 0: 1
1: 0
2: 4
3: 18
4: 1716
1185097267_1185097273 -8 Left 1185097267 22:48817604-48817626 CCCTTCTGGAGCTGGTTCCCAGG 0: 1
1: 1
2: 3
3: 30
4: 204
Right 1185097273 22:48817619-48817641 TTCCCAGGAAGGACCCATAGGGG 0: 1
1: 0
2: 4
3: 18
4: 1716

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185097273 Original CRISPR TTCCCAGGAAGGACCCATAG GGG Intronic
900469858 1:2848413-2848435 TGCCCAGGAGGTACCCAGAGAGG + Intergenic
904828899 1:33294367-33294389 CTCTCAGGAAGGACACAGAGGGG + Intronic
908518433 1:64917080-64917102 TTCCCAGGAATGCCCCAAACAGG - Intronic
910942477 1:92551701-92551723 TTCCCAGGAAGAGACCATACTGG - Intronic
912346360 1:108966828-108966850 TTCCCAGGGAGGACATTTAGAGG - Intergenic
913734686 1:121765416-121765438 TTCCAACGAAGGACTCAAAGAGG - Intergenic
913790969 1:122525812-122525834 TTCCAAGGAAGGCCTCAAAGAGG - Intergenic
913791883 1:122542472-122542494 TTCCAAGGAAGGCCTCAAAGAGG - Intergenic
913795110 1:122600282-122600304 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
913797346 1:122639710-122639732 TTCCAACGAAGGACTCAAAGGGG - Intergenic
913805150 1:122781141-122781163 TTCCAACGAAGGACTCAAAGGGG - Intergenic
913816755 1:122988870-122988892 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
913820052 1:123047656-123047678 TTCCAACGAAGGCCTCATAGAGG - Intergenic
913832857 1:123277748-123277770 TTCCAAGGAAGGCCTCAAAGAGG - Intergenic
913833335 1:123286234-123286256 TTCCAAGGAAGGTCTCAAAGAGG - Intergenic
913834552 1:123307478-123307500 TTCCAACGAAGGCCCCAAAGGGG - Intergenic
913836770 1:123347254-123347276 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
913840020 1:123405361-123405383 TTCCAATGAAGGACTCAAAGAGG - Intergenic
913852880 1:123636640-123636662 TTCCAACGAAGGCCCCAAAGGGG - Intergenic
913853159 1:123641744-123641766 TTCCAACGAAGGCCTCATAGAGG - Intergenic
913862315 1:123805586-123805608 TTCCAACGAAGGACTCAAAGAGG - Intergenic
913866166 1:123875087-123875109 TTCCAAGGAAGGCCTCAAAGAGG - Intergenic
913869152 1:123928604-123928626 TTCCAACGAAGGACTCAAAGAGG - Intergenic
913875158 1:124036676-124036698 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
913877594 1:124080198-124080220 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
913884190 1:124198037-124198059 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
913885981 1:124229981-124230003 TTCCAACGAAGGACCCTAAGAGG - Intergenic
913886959 1:124247663-124247685 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
913889548 1:124293706-124293728 TTCCAAGGAAGGCCTCAAAGAGG - Intergenic
913891907 1:124336212-124336234 TTCCAACGAAGGCCTCATAGAGG - Intergenic
913894049 1:124374295-124374317 TTCCAACGAAGGACTCAAAGAGG - Intergenic
913896412 1:124416954-124416976 TTCCAACGAAGGACTCAAAGGGG - Intergenic
913903712 1:124547790-124547812 TTCCAACGAAGGCCCCAAAGGGG - Intergenic
913906959 1:124605916-124605938 TTCCAACGAAGGACTCAAAGAGG - Intergenic
913907150 1:124609314-124609336 TTCCAACGAAGGCCCCAAAGGGG - Intergenic
913912410 1:124703817-124703839 TTCCCACGAAGGCCTCAAAGAGG - Intergenic
913914049 1:124733046-124733068 TTCCAAGGAAGGCCTCAAAGAGG - Intergenic
913934923 1:125029011-125029033 TTCCAACGAAGGCCCCAAAGTGG - Intergenic
914903915 1:151728537-151728559 TTCCCAGGAAGGGCTCCCAGAGG - Intronic
915332917 1:155124792-155124814 TTTCCAGAAAGGACTCATGGAGG + Intergenic
915556703 1:156664812-156664834 GTCCCAGGAAGGCCCCGTGGGGG + Intergenic
918245593 1:182656752-182656774 CTCCCAGGAAGGGCCCATGAGGG - Intronic
920267218 1:204733117-204733139 TGACCAGGGAGGGCCCATAGAGG + Intergenic
922785179 1:228279098-228279120 TTCCCAGGAAGGAACCCTGCCGG + Intronic
1063906874 10:10789173-10789195 TCCCCAGAGAGGAACCATAGAGG - Intergenic
1064445921 10:15392670-15392692 TTCACAGGCAGGGGCCATAGTGG - Intergenic
1064997494 10:21309610-21309632 TTCCCAGGAAGGAGCATCAGGGG - Intergenic
1065898897 10:30187732-30187754 TTCCCAGGATTGACTCAAAGGGG - Intergenic
1066821807 10:39503143-39503165 TTCCAAGGAAGGCCTCAAAGCGG - Intergenic
1066823926 10:39537530-39537552 TTCCAACGAAGGCCTCATAGTGG - Intergenic
1066825263 10:39564155-39564177 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066825933 10:39576558-39576580 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066826502 10:39592510-39592532 TTCCAAGGAAGGCCTCAAAGAGG - Intergenic
1066839175 10:39884034-39884056 TTCCAAGGAAGGCCTCAAAGAGG - Intergenic
1066842165 10:39938154-39938176 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066842220 10:39939173-39939195 TTCCAAGGAAGGTCTCAAAGAGG - Intergenic
1066842234 10:39939511-39939533 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066842302 10:39940868-39940890 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066842370 10:39942225-39942247 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066842503 10:39944942-39944964 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066842607 10:39946981-39947003 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066842879 10:39952407-39952429 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066843021 10:39955122-39955144 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066843084 10:39956480-39956502 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066843141 10:39957502-39957524 TTCCAAGGAAGGCCTCAAAGAGG - Intergenic
1066843221 10:39959198-39959220 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066843366 10:39961916-39961938 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066843436 10:39963271-39963293 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066843569 10:39965986-39966008 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066843635 10:39967341-39967363 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066843826 10:39971073-39971095 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066843875 10:39972091-39972113 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066843946 10:39973449-39973471 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066844018 10:39974808-39974830 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066844226 10:39978886-39978908 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066844294 10:39980245-39980267 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066844413 10:39982627-39982649 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066844725 10:39988742-39988764 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066845091 10:39995870-39995892 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066845444 10:40002999-40003021 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066845513 10:40004358-40004380 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066845606 10:40006053-40006075 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066845679 10:40007411-40007433 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066845743 10:40008770-40008792 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066845811 10:40010114-40010136 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066845877 10:40011472-40011494 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066845949 10:40012830-40012852 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066846039 10:40014527-40014549 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066846107 10:40015885-40015907 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066846177 10:40017243-40017265 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066846279 10:40019282-40019304 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066846403 10:40021657-40021679 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066846472 10:40023015-40023037 TTCCAAAGAAGGGCTCATAGAGG - Intergenic
1066846597 10:40025391-40025413 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066846667 10:40026751-40026773 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066846736 10:40028109-40028131 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066846801 10:40029467-40029489 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066847009 10:40033541-40033563 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066847075 10:40034899-40034921 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066847148 10:40036257-40036279 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066847285 10:40038973-40038995 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066847423 10:40041690-40041712 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066847567 10:40044403-40044425 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066847632 10:40045761-40045783 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066847836 10:40049836-40049858 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066847906 10:40051194-40051216 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066847973 10:40052552-40052574 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066848039 10:40053910-40053932 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066848105 10:40055268-40055290 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066848170 10:40056626-40056648 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066848238 10:40057984-40058006 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066848378 10:40060702-40060724 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066848447 10:40062059-40062081 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066848514 10:40063417-40063439 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066848581 10:40064775-40064797 TTCCAATGAAGGGCTCATAGAGG - Intergenic
1066849147 10:40075981-40076003 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066849334 10:40079715-40079737 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066849762 10:40088199-40088221 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066849830 10:40089557-40089579 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066849897 10:40090915-40090937 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066849964 10:40092272-40092294 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066850034 10:40093630-40093652 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066850102 10:40094989-40095011 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066850258 10:40098050-40098072 TTCCCACGAAGGCCTCAAAGGGG - Intergenic
1066850513 10:40103140-40103162 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066850580 10:40104498-40104520 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066850698 10:40106877-40106899 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066850871 10:40110272-40110294 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066850941 10:40111626-40111648 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066851044 10:40113664-40113686 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066851111 10:40115022-40115044 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066851178 10:40116380-40116402 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066851244 10:40117738-40117760 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066851310 10:40119095-40119117 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066851377 10:40120453-40120475 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066851446 10:40121811-40121833 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066851515 10:40123169-40123191 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066851547 10:40123847-40123869 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066851619 10:40125205-40125227 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066851686 10:40126563-40126585 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066851924 10:40131323-40131345 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066851993 10:40132677-40132699 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066852064 10:40134034-40134056 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066852370 10:40140146-40140168 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066852438 10:40141504-40141526 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066852554 10:40143883-40143905 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066852622 10:40145241-40145263 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066852691 10:40146601-40146623 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066852935 10:40151353-40151375 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066853002 10:40152711-40152733 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066853071 10:40154069-40154091 TTCCAAGGAAGGGCTCATAGAGG - Intergenic
1066853143 10:40155427-40155449 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066853211 10:40156786-40156808 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066853382 10:40160183-40160205 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066853520 10:40162900-40162922 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066853621 10:40164938-40164960 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066853738 10:40167317-40167339 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066853804 10:40168676-40168698 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066853999 10:40172414-40172436 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066854066 10:40173777-40173799 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066854133 10:40175135-40175157 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066854201 10:40176493-40176515 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066854269 10:40177851-40177873 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066854335 10:40179208-40179230 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066854488 10:40182264-40182286 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066854559 10:40183622-40183644 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066854847 10:40189054-40189076 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066854914 10:40190412-40190434 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066855067 10:40193472-40193494 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066855191 10:40195848-40195870 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066855259 10:40197206-40197228 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066855330 10:40198564-40198586 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066855399 10:40199921-40199943 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066855814 10:40208075-40208097 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066855894 10:40209775-40209797 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066856031 10:40212491-40212513 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066856100 10:40213849-40213871 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066856168 10:40215207-40215229 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066856678 10:40225398-40225420 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066856748 10:40226756-40226778 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066856864 10:40229133-40229155 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066856933 10:40230491-40230513 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066857001 10:40231849-40231871 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066857054 10:40232867-40232889 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066857176 10:40235244-40235266 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066857242 10:40236602-40236624 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066857343 10:40238640-40238662 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066857411 10:40239998-40240020 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066857512 10:40242036-40242058 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066857651 10:40244753-40244775 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066857718 10:40246112-40246134 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066857883 10:40249505-40249527 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066858021 10:40252222-40252244 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066858161 10:40254939-40254961 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066858231 10:40256298-40256320 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066858369 10:40259019-40259041 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066858388 10:40259357-40259379 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066858458 10:40260714-40260736 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066858526 10:40262072-40262094 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066858641 10:40264449-40264471 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066858918 10:40269881-40269903 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066859022 10:40271919-40271941 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066859089 10:40273279-40273301 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066859155 10:40274637-40274659 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066859223 10:40275995-40276017 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066859516 10:40281764-40281786 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066859586 10:40283121-40283143 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066860015 10:40291611-40291633 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066860082 10:40292969-40292991 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066860150 10:40294327-40294349 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066860218 10:40295685-40295707 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066860288 10:40297043-40297065 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066860355 10:40298399-40298421 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066860422 10:40299757-40299779 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066860441 10:40300095-40300117 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066860578 10:40302813-40302835 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066860715 10:40305529-40305551 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066860783 10:40306887-40306909 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066860854 10:40308246-40308268 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066860922 10:40309604-40309626 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066860992 10:40310961-40310983 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066861057 10:40312319-40312341 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066861124 10:40313677-40313699 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066861312 10:40317413-40317435 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066861379 10:40318769-40318791 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066861448 10:40320127-40320149 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066861516 10:40321481-40321503 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066861584 10:40322839-40322861 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066861651 10:40324197-40324219 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066861842 10:40327934-40327956 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066861910 10:40329291-40329313 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066861976 10:40330649-40330671 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066862057 10:40332348-40332370 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066862393 10:40339138-40339160 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066862469 10:40340495-40340517 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066862487 10:40340833-40340855 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066862631 10:40343552-40343574 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066862683 10:40344570-40344592 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066862848 10:40347966-40347988 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066862915 10:40349324-40349346 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066862983 10:40350682-40350704 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066863086 10:40352720-40352742 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066863104 10:40353058-40353080 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066863173 10:40354416-40354438 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066863241 10:40355773-40355795 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066863309 10:40357132-40357154 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066863377 10:40358490-40358512 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066863444 10:40359848-40359870 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066863513 10:40361206-40361228 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066863628 10:40363582-40363604 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066863928 10:40369686-40369708 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066864458 10:40380210-40380232 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066864592 10:40382926-40382948 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066864666 10:40384284-40384306 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066864763 10:40386324-40386346 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066865557 10:40402294-40402316 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066865627 10:40403652-40403674 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066865743 10:40406028-40406050 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066865957 10:40410439-40410461 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066866299 10:40417230-40417252 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066866488 10:40420966-40420988 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066866627 10:40423683-40423705 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066866698 10:40425041-40425063 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066866976 10:40430475-40430497 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066867046 10:40431833-40431855 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066867113 10:40433191-40433213 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066867182 10:40434549-40434571 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066867427 10:40439301-40439323 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066867620 10:40443035-40443057 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066867639 10:40443373-40443395 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066867706 10:40444731-40444753 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066867771 10:40446088-40446110 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066867955 10:40449824-40449846 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066868024 10:40451182-40451204 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066868092 10:40452540-40452562 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066868425 10:40459339-40459361 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066868492 10:40460698-40460720 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066868512 10:40461036-40461058 TTCCAACGAAGGACTCAAAGAGG - Intergenic
1066868682 10:40464430-40464452 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066868896 10:40468502-40468524 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066869014 10:40470882-40470904 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066869106 10:40472578-40472600 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066869160 10:40473598-40473620 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066869263 10:40475637-40475659 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066869613 10:40482772-40482794 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066870192 10:40494063-40494085 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066870258 10:40495421-40495443 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066870453 10:40499153-40499175 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066870523 10:40500512-40500534 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066870588 10:40501869-40501891 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066870708 10:40504246-40504268 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066871022 10:40510354-40510376 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066871590 10:40521567-40521589 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066871657 10:40522925-40522947 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066871676 10:40523263-40523285 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066871840 10:40526658-40526680 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066871858 10:40526996-40527018 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066871927 10:40528354-40528376 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066871994 10:40529712-40529734 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066872114 10:40532089-40532111 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066872161 10:40533106-40533128 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066872235 10:40534465-40534487 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066872303 10:40535823-40535845 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066872322 10:40536161-40536183 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066872388 10:40537519-40537541 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066872966 10:40549062-40549084 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066872984 10:40549399-40549421 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066873055 10:40550753-40550775 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066873121 10:40552112-40552134 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066873190 10:40553471-40553493 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066873258 10:40554830-40554852 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066873436 10:40558566-40558588 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066873504 10:40559924-40559946 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066873574 10:40561282-40561304 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066873692 10:40563659-40563681 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066873759 10:40565017-40565039 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066873827 10:40566375-40566397 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066873917 10:40568071-40568093 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066874055 10:40570789-40570811 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066874122 10:40572148-40572170 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066874189 10:40573506-40573528 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066874257 10:40574864-40574886 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066874378 10:40577240-40577262 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066874605 10:40581656-40581678 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066874739 10:40584014-40584036 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066874790 10:40585031-40585053 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066874860 10:40586389-40586411 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066875728 10:40603705-40603727 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066875824 10:40605741-40605763 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066876197 10:40613210-40613232 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066876593 10:40621015-40621037 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066876661 10:40622373-40622395 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066876746 10:40624071-40624093 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066876813 10:40625429-40625451 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066876880 10:40626787-40626809 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066876963 10:40628485-40628507 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066877030 10:40629843-40629865 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066877132 10:40631881-40631903 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066877199 10:40633239-40633261 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066877267 10:40634596-40634618 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066877334 10:40635954-40635976 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066877399 10:40637313-40637335 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066877467 10:40638671-40638693 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066877517 10:40639689-40639711 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066877616 10:40641726-40641748 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066877970 10:40648861-40648883 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066878218 10:40653617-40653639 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066878287 10:40654973-40654995 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066878409 10:40657349-40657371 TTCCAAGGAAGGGCTCATAGAGG - Intergenic
1066878573 10:40660745-40660767 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066878847 10:40666175-40666197 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066879235 10:40673990-40674012 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066879300 10:40675348-40675370 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066879769 10:40684511-40684533 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066879820 10:40685530-40685552 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066879870 10:40686548-40686570 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066880074 10:40690624-40690646 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066880334 10:40695705-40695727 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066880402 10:40697063-40697085 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066880469 10:40698421-40698443 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066880671 10:40702495-40702517 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066880725 10:40703513-40703535 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066880896 10:40706910-40706932 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066880947 10:40707928-40707950 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066881083 10:40710645-40710667 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066881135 10:40711663-40711685 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066881294 10:40714719-40714741 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066881561 10:40720154-40720176 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066881683 10:40722532-40722554 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066881840 10:40724254-40724276 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066881911 10:40725611-40725633 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066882236 10:40732064-40732086 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066882405 10:40735460-40735482 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066882543 10:40738176-40738198 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066882698 10:40741232-40741254 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066882754 10:40742250-40742272 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066882823 10:40743608-40743630 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066882891 10:40744966-40744988 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066882941 10:40745984-40746006 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066883010 10:40747340-40747362 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066883028 10:40747679-40747701 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066883118 10:40749377-40749399 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066883168 10:40750395-40750417 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066883333 10:40753790-40753812 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066883351 10:40754128-40754150 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066883634 10:40759896-40759918 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066884030 10:40767710-40767732 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066884264 10:40772465-40772487 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066884331 10:40773823-40773845 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066884537 10:40777900-40777922 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066884661 10:40780278-40780300 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066884965 10:40786395-40786417 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066885084 10:40788773-40788795 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066885171 10:40790471-40790493 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066885225 10:40791489-40791511 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066885434 10:40795564-40795586 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066885868 10:40804059-40804081 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066886224 10:40810848-40810870 TTCCAAGGAAGGGCTCATAGAGG - Intergenic
1066886326 10:40812885-40812907 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066886393 10:40814243-40814265 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066886463 10:40815598-40815620 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066886672 10:40819670-40819692 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066886738 10:40821032-40821054 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066886910 10:40824430-40824452 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066886988 10:40826127-40826149 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066887040 10:40827145-40827167 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066887158 10:40829519-40829541 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066887327 10:40832918-40832940 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066887719 10:40840726-40840748 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066887876 10:40843782-40843804 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066888341 10:40852946-40852968 TTCCAACGAAGGACTCAAAGAGG - Intergenic
1066888537 10:40857006-40857028 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066888588 10:40858024-40858046 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066888639 10:40859042-40859064 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066888689 10:40860060-40860082 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066888788 10:40862099-40862121 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066888840 10:40863116-40863138 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066888964 10:40865491-40865513 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066889120 10:40868549-40868571 TTCCAAGGAAGGGCTCATAGAGG - Intergenic
1066889172 10:40869567-40869589 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066889310 10:40872285-40872307 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066889550 10:40877040-40877062 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066889818 10:40882130-40882152 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066890042 10:40886543-40886565 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066890093 10:40887561-40887583 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066890400 10:40893678-40893700 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066890451 10:40894695-40894717 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066891074 10:40906575-40906597 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066891153 10:40908272-40908294 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066891288 10:40910988-40911010 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066891389 10:40913025-40913047 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066891459 10:40914385-40914407 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066891511 10:40915403-40915425 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066891878 10:40922869-40922891 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066892280 10:40930500-40930522 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066892407 10:40932877-40932899 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066892618 10:40937292-40937314 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066892725 10:40939325-40939347 TTCCAACGAAGGACTCAAAGAGG - Intergenic
1066892821 10:40941361-40941383 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066892889 10:40942715-40942737 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066892956 10:40944073-40944095 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066893284 10:40950520-40950542 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066893336 10:40951538-40951560 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066893443 10:40953576-40953598 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066894210 10:40968867-40968889 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066894278 10:40970225-40970247 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066894785 10:40980414-40980436 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066894942 10:40983472-40983494 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066895439 10:40993664-40993686 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066895801 10:41000801-41000823 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066895902 10:41002836-41002858 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066895977 10:41004192-41004214 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066896225 10:41008942-41008964 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066896367 10:41011656-41011678 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066896471 10:41013696-41013718 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066896732 10:41018793-41018815 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066896959 10:41023209-41023231 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066897029 10:41024567-41024589 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066897144 10:41026942-41026964 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066897248 10:41028977-41028999 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066897670 10:41037470-41037492 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066897878 10:41041547-41041569 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066897915 10:41042225-41042247 TTCCAAGGAAGGCCTCAAAGAGG - Intergenic
1066898243 10:41048675-41048697 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066898344 10:41050712-41050734 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066898538 10:41054446-41054468 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066898657 10:41056821-41056843 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066898711 10:41057838-41057860 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066898834 10:41060215-41060237 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066899025 10:41063953-41063975 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066899076 10:41064971-41064993 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066899246 10:41068365-41068387 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066899346 10:41070402-41070424 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066899660 10:41076857-41076879 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066899910 10:41081955-41081977 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066899963 10:41082972-41082994 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066900139 10:41086370-41086392 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066900189 10:41087387-41087409 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066900356 10:41090781-41090803 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066900532 10:41094175-41094197 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066900632 10:41096213-41096235 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066900861 10:41100626-41100648 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066900969 10:41102661-41102683 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066901181 10:41106734-41106756 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066901235 10:41107752-41107774 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066901470 10:41112510-41112532 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066901628 10:41115568-41115590 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066901648 10:41115906-41115928 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066901701 10:41116924-41116946 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066901874 10:41120320-41120342 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066901976 10:41122359-41122381 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066902029 10:41123377-41123399 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066902065 10:41124056-41124078 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066902322 10:41129153-41129175 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066902443 10:41131531-41131553 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066902698 10:41136625-41136647 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066903011 10:41142743-41142765 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066903062 10:41143762-41143784 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066903164 10:41145798-41145820 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066903719 10:41156332-41156354 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066903769 10:41157349-41157371 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066903994 10:41161764-41161786 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066904274 10:41167200-41167222 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066904397 10:41169579-41169601 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066904451 10:41170596-41170618 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066904509 10:41171613-41171635 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066905001 10:41181464-41181486 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066905053 10:41182481-41182503 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066905427 10:41189954-41189976 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066905903 10:41199121-41199143 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066906339 10:41207614-41207636 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066906439 10:41209650-41209672 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066906564 10:41212023-41212045 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066906966 10:41220177-41220199 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066907347 10:41227651-41227673 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066908265 10:41245658-41245680 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066908436 10:41249057-41249079 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066908470 10:41249736-41249758 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066908991 10:41259929-41259951 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066909461 10:41269099-41269121 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066909617 10:41272156-41272178 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066910867 10:41296615-41296637 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066910886 10:41296953-41296975 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066911044 10:41300011-41300033 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066911858 10:41315632-41315654 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066911927 10:41316989-41317011 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066911979 10:41318009-41318031 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066912032 10:41319027-41319049 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066912186 10:41322084-41322106 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066912271 10:41323782-41323804 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066912285 10:41324120-41324142 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066912336 10:41325138-41325160 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066912958 10:41337373-41337395 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066913166 10:41341449-41341471 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066913331 10:41344507-41344529 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066913824 10:41354356-41354378 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066913977 10:41357412-41357434 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066914382 10:41365228-41365250 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066914505 10:41367603-41367625 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066914989 10:41377113-41377135 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066915040 10:41378130-41378152 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066915092 10:41379148-41379170 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066915196 10:41381186-41381208 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066915707 10:41391383-41391405 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066916232 10:41401576-41401598 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066916856 10:41413801-41413823 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066916925 10:41415159-41415181 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066917179 10:41420254-41420276 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066917237 10:41421274-41421296 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066917972 10:41435890-41435912 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066918296 10:41442344-41442366 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066918447 10:41445402-41445424 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066918985 10:41455935-41455957 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066919196 10:41460013-41460035 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066920131 10:41478366-41478388 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066920184 10:41479384-41479406 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066920450 10:41484815-41484837 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066920501 10:41485834-41485856 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066920556 10:41486853-41486875 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066920612 10:41487873-41487895 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066920768 10:41490929-41490951 TTCCAACGAAGGGCTCATAGAGG - Intergenic
1066921576 10:41506989-41507011 TTCCAAGGAAGGTCTCAAAGAGG - Intergenic
1066924134 10:41556460-41556482 TTCCAACGAAGGACTCAGAGAGG - Intergenic
1066924261 10:41558838-41558860 TTCCAACGAAGGACTCAAAGGGG - Intergenic
1066924447 10:41562231-41562253 TTCCAACGAAGGACTCAGAGAGG - Intergenic
1066924540 10:41563930-41563952 TTCCAACGAAGGACTCAGAGAGG - Intergenic
1066925622 10:41583963-41583985 TTCCAACGAAGGACTCAGAGAGG - Intergenic
1066925837 10:41588037-41588059 TTCCAACGAAGGACTCAGAGAGG - Intergenic
1066926132 10:41593469-41593491 TTCCAACGAAGGACTCAGAGAGG - Intergenic
1066926970 10:41708412-41708434 TTCCAACGAAGGACACAAAGAGG - Intergenic
1069811303 10:71161925-71161947 TTCCCAGGAAGGAGAGAGAGGGG + Intergenic
1069814762 10:71186724-71186746 TTCCCCAGAAGGACCCCCAGTGG - Intergenic
1069951911 10:72024885-72024907 TTGCCAGCAAGGACCCATAGAGG + Intergenic
1073511801 10:104047102-104047124 TGCCCAGACAGGAGCCATAGAGG - Intronic
1075873168 10:125785963-125785985 TCCCCAGGAAGGACACAAGGAGG + Intronic
1076236515 10:128867780-128867802 TTCCCAGGAAGGAACCAAATAGG + Intergenic
1076767861 10:132646444-132646466 TTCCCAGGCAGGACCCAGTTGGG - Intronic
1077549400 11:3193391-3193413 CTCCCAGGAGGCACCCAGAGAGG + Intergenic
1079451680 11:20604190-20604212 TTGCTGGGAAGGACCCCTAGCGG + Intronic
1079779955 11:24589127-24589149 TTCCCAGAAAGCAGCCAGAGGGG - Intronic
1080866725 11:36202018-36202040 TCCCCAGGAAGTACCCAAGGAGG - Intronic
1082156193 11:48818156-48818178 TTCCAACGAAGGACTCAAAGCGG - Intergenic
1082157398 11:48841622-48841644 TTCAAAGGAAGGCCCCAAAGTGG - Intergenic
1082325539 11:51136664-51136686 TTCCAAGGAAGGCCACAAAGTGG - Intergenic
1082326126 11:51145166-51145188 TTCGAAGGAAGGCCCCAAAGTGG - Intergenic
1082339334 11:51336947-51336969 TTCGAAGGAAGGCCCCAAAGTGG - Intergenic
1082343125 11:51392198-51392220 TTCCAAGGAAGGCCACAAAGTGG - Intergenic
1082343701 11:51400696-51400718 TTCCAAGGAAGGCCACAAAGTGG - Intergenic
1082347209 11:51451705-51451727 TTCGAAGGAAGGCCCCAAAGTGG - Intergenic
1082349855 11:51489951-51489973 TTCGAAGGAAGGCCCCAAAGTGG - Intergenic
1082352256 11:51524643-51524665 TTCCAAGGAAGGCCACAAAGTGG - Intergenic
1082354549 11:51557799-51557821 TTCGAAGGAAGGACACAAAGTGG - Intergenic
1082357854 11:51606250-51606272 TTCCAAGGAAGGCCACAAAGTGG - Intergenic
1082360421 11:51643842-51643864 TTCGAAGGAAGGCCCCAAAGTGG - Intergenic
1082364197 11:51698922-51698944 TTCCAAGGAAGGCCACAAAGTGG - Intergenic
1082364550 11:51704023-51704045 TTCGAAGGAAGGCCCCAAAGTGG - Intergenic
1082367310 11:51743977-51743999 TTCCAAGGAAGGCCACAAAGTGG - Intergenic
1082374979 11:51855344-51855366 TTCCAAGGAAGGCCACAAAGTGG - Intergenic
1082375687 11:51865544-51865566 TTCAAAGGAAGGCCACATAGTGG - Intergenic
1082379142 11:51915696-51915718 TTCCAAGGAAGGCCACAAAGTGG - Intergenic
1082379796 11:51925047-51925069 TTCCAAGGAAGGCCACAAAGTGG - Intergenic
1082392904 11:52116445-52116467 TTCGAAGGAAGGCCCCAAAGTGG - Intergenic
1082397430 11:52182045-52182067 TTCCAAGGAAGGCCACAAAGTGG - Intergenic
1082397490 11:52182895-52182917 TTCGAAGGAAGGCCCCAAAGTGG - Intergenic
1082401316 11:52238145-52238167 TTCGAAGGAAGGCCCCAAAGTGG - Intergenic
1082403249 11:52266365-52266387 TTCGAAGGAAGGCCACATAGTGG - Intergenic
1082408465 11:52341662-52341684 TTCGAAGGAAGGCCCCAAAGTGG - Intergenic
1082417745 11:52475320-52475342 TTCGAAGGAAGGACACAAAGTGG - Intergenic
1082418744 11:52489774-52489796 TTCGAAGGAAGGCCCCAAAGTGG - Intergenic
1082432360 11:52686972-52686994 TTCCAAGGAAGGCCACAAAGTGG - Intergenic
1082432717 11:52692069-52692091 TTCGAAGGAAGGACACAAAGTGG - Intergenic
1082436892 11:52752422-52752444 TTCCAAGGAAGGCCACAAAGTGG - Intergenic
1082437963 11:52767725-52767747 TTCCAAGGAAGGCCACAAAGTGG - Intergenic
1082442270 11:52829746-52829768 TTCCAAGGAAGGCCACAAAGTGG - Intergenic
1082443381 11:52845897-52845919 TTCGAAGGAAGGACACAAAGTGG - Intergenic
1082444218 11:52857800-52857822 TTCGAAGGAAGGCCCCAAAGTGG - Intergenic
1082454967 11:53014224-53014246 TTCGAAGGAAGGACACAAAGTGG - Intergenic
1082455262 11:53018473-53018495 TTCGAAGGAAGGACACAAAGTGG - Intergenic
1082457943 11:53057583-53057605 TTCGAAGGAAGGCCCCAAAGTGG - Intergenic
1082464008 11:53145132-53145154 TTCGAAGGAAGGCCCCAAAGTGG - Intergenic
1082473428 11:53281366-53281388 TTCCAAGGAAGGCCACAAAGTGG - Intergenic
1082476835 11:53330675-53330697 TTCGAAGGAAGGACACAAAGTGG - Intergenic
1082477888 11:53345975-53345997 TTCGAAGGAAGGCCCCAAAGTGG - Intergenic
1082481375 11:53396149-53396171 TTCGAAGGAAGGCCCCAAAGTGG - Intergenic
1082482143 11:53407205-53407227 TTCCAAGGAAGGCCACAAAGTGG - Intergenic
1082487119 11:53478594-53478616 TTCCAAGGAAGGCCACAAAGTGG - Intergenic
1082489887 11:53518556-53518578 TTCGAAGGAAGGCCCCAAAGTGG - Intergenic
1082492335 11:53553001-53553023 TTCGAAGGAAGGCCCCAAAGTGG - Intergenic
1082495367 11:53597212-53597234 TTCCAAGGAAGGCCACAAAGTGG - Intergenic
1082502287 11:53697190-53697212 TTCGAAGGAAGGCCCCAAAGTGG - Intergenic
1082505961 11:53750750-53750772 TTCCAAGGAAGGCCACAAAGTGG - Intergenic
1082508013 11:53780502-53780524 TTCGAAGGAAGGCCCCAAAGTGG - Intergenic
1082511481 11:53830668-53830690 TTCCAAGGAAGGCCACAAAGTGG - Intergenic
1082513744 11:53862987-53863009 TTCGAAGGAAGGCCCCAAAGTGG - Intergenic
1082514977 11:53880841-53880863 TTCGAAGGAAGGCCCCAAAGTGG - Intergenic
1082517506 11:53917398-53917420 TTCCAAGGAAGGCCACAAAGTGG - Intergenic
1082520329 11:53958224-53958246 TTCCAAGGAAGGCCACAAAGTGG - Intergenic
1082522143 11:53984585-53984607 TTCGAAGGAAGGACACAAAGTGG - Intergenic
1082525636 11:54035076-54035098 TTCGAAGGAAGGCCCCAAAGTGG - Intergenic
1082526451 11:54046789-54046811 TTCCAAGGAAGGCCACAAAGTGG - Intergenic
1082527439 11:54061245-54061267 TTCGAAGGAAGGCCCCAAAGTGG - Intergenic
1082530622 11:54107169-54107191 TTCGAAGGAAGGACACAAAGTGG - Intergenic
1082532389 11:54132677-54132699 TTCGAAGGAAGGCCCCAAAGTGG - Intergenic
1082539306 11:54233001-54233023 TTCGAAGGAAGGCCCCAAAGTGG - Intergenic
1082543658 11:54296093-54296115 TTCGAAGGAAGGACACAAAGTGG - Intergenic
1082545530 11:54323297-54323319 TTCGAAGGAAGGCCCCAAAGTGG - Intergenic
1082545944 11:54329247-54329269 TTCCAAGGAAGGCCACAAAGTGG - Intergenic
1083014887 11:59443255-59443277 TGCCCAGGAAGGTCACAAAGAGG - Exonic
1083356992 11:62074226-62074248 TTCCCAGGAAAGACTTATACAGG + Intergenic
1083987680 11:66227142-66227164 TGCCCAGGAAGGACATAGAGGGG - Intronic
1084827539 11:71742578-71742600 TTACCAGGAACGACCCCCAGTGG + Intergenic
1085015829 11:73173569-73173591 TTCCCAGCACGGACCCATAAAGG - Intergenic
1085566760 11:77521076-77521098 TTCCCATAAAGGTCCCATAAAGG - Intronic
1087011657 11:93520037-93520059 TTTCCAGTAAGGACCTATAGTGG - Intronic
1088505584 11:110523533-110523555 TTCCCAGGCTGGCCCCATCGTGG - Intergenic
1091150454 11:133323775-133323797 TTACCAGGATGGCCCCTTAGTGG - Intronic
1093971570 12:25381071-25381093 AGCCAAGGAAGGACCCAGAGAGG + Intergenic
1094878699 12:34686192-34686214 TTCCCAGGAAGGCCTCAAAGAGG - Intergenic
1094878983 12:34691849-34691871 TTCCAAGGAAGGCCTCAAAGAGG - Intergenic
1094880546 12:34771900-34771922 TTCCAACGAAGGACACAAAGAGG - Intergenic
1094880698 12:34774617-34774639 TTCCAACGAAGGACACAAAGAGG - Intergenic
1094881187 12:34783105-34783127 TTCCAACGAAGGACACAAAGAGG - Intergenic
1094881355 12:34786162-34786184 TTCCAACGAAGGACACAAAGAGG - Intergenic
1094881406 12:34787181-34787203 TTCCAACGAAGGACTCAAAGAGG - Intergenic
1094881531 12:34789559-34789581 TTCCAACGAAGGACACAAAGAGG - Intergenic
1094881696 12:34792616-34792638 TTCCAACGAAGGACTCAAAGAGG - Intergenic
1094881864 12:34795673-34795695 TTCCAACGAAGGACACAAAGAGG - Intergenic
1094881917 12:34796691-34796713 TTCCAACGAAGGACTCAAAGAGG - Intergenic
1094882210 12:34801951-34801973 TTCCAACGAAGGACTCAAAGAGG - Intergenic
1094882273 12:34803310-34803332 TTCCAACGAAGGACACAAAGAGG - Intergenic
1094882452 12:34806709-34806731 TTCCAACGAAGGACTCAAAGAGG - Intergenic
1094882687 12:34811127-34811149 TTCCAACGAAGGACACAAAGAGG - Intergenic
1094882721 12:34811806-34811828 TTCCAACGAAGGACTCAAAGAGG - Intergenic
1094882845 12:34814183-34814205 TTCCAACGAAGGACACAAAGAGG - Intergenic
1094883152 12:34819666-34819688 TTCCAACGAAGGACACAAAGAGG - Intergenic
1094883286 12:34822098-34822120 TTCCAACGAAGGACTCAAAGAGG + Intergenic
1094883670 12:34835752-34835774 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094883713 12:34836431-34836453 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094884015 12:34841186-34841208 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094884157 12:34843563-34843585 TTCCAATGAAGGCCCCAAAGAGG - Intergenic
1094884490 12:34848999-34849021 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094885027 12:34857510-34857532 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094885112 12:34858868-34858890 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094885198 12:34860227-34860249 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094885373 12:34862946-34862968 TTCCAAGGAAGGCCTCAAAGAGG - Intergenic
1094885796 12:34869742-34869764 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094886044 12:34873819-34873841 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094886818 12:34886384-34886406 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094886868 12:34887064-34887086 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094887094 12:34890801-34890823 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094887197 12:34892500-34892522 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094887528 12:34897927-34897949 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094887920 12:34904379-34904401 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094887966 12:34905059-34905081 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094888126 12:34907775-34907797 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094888784 12:34918644-34918666 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094888908 12:34920683-34920705 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094889199 12:34925436-34925458 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094890204 12:34941741-34941763 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094890365 12:34944458-34944480 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094890455 12:34945814-34945836 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094890518 12:34946833-34946855 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094890682 12:34949552-34949574 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094890847 12:34952267-34952289 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094890930 12:34953624-34953646 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094891180 12:34957701-34957723 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094891225 12:34958381-34958403 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094891309 12:34959740-34959762 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094891643 12:34965175-34965197 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094891811 12:34967894-34967916 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094892214 12:34974352-34974374 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094892546 12:34979788-34979810 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094892758 12:34983185-34983207 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094892842 12:34984544-34984566 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094893010 12:34987263-34987285 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094893139 12:34989301-34989323 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094893471 12:34994732-34994754 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094893557 12:34996091-34996113 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094893707 12:34998469-34998491 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094893726 12:34998809-34998831 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094893815 12:35000165-35000187 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094893896 12:35001524-35001546 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094893941 12:35002204-35002226 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094894149 12:35005601-35005623 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094894393 12:35009676-35009698 TTCCAATGAAGGCCCCAAAGAGG - Intergenic
1094894479 12:35011036-35011058 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094894564 12:35012395-35012417 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094894712 12:35014772-35014794 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094895002 12:35019530-35019552 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094895144 12:35021905-35021927 TTCCAAGGAAGGCCTCAAAGAGG - Intergenic
1094895205 12:35022924-35022946 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094895371 12:35025643-35025665 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094895630 12:35029720-35029742 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094895715 12:35031079-35031101 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094895801 12:35032439-35032461 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094895968 12:35035157-35035179 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094896223 12:35039231-35039253 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094896393 12:35041951-35041973 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094896887 12:35050105-35050127 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094896933 12:35050785-35050807 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094897013 12:35052143-35052165 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094897087 12:35053502-35053524 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094897171 12:35054861-35054883 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094897255 12:35056219-35056241 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094897339 12:35057578-35057600 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094897583 12:35061655-35061677 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094897665 12:35063013-35063035 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094898119 12:35070487-35070509 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094898208 12:35071847-35071869 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094898295 12:35073207-35073229 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094898376 12:35074566-35074588 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094898459 12:35075927-35075949 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094898726 12:35080000-35080022 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094898812 12:35081360-35081382 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094898897 12:35082718-35082740 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094898983 12:35084078-35084100 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094899398 12:35090872-35090894 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094899902 12:35099024-35099046 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094899948 12:35099707-35099729 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094900245 12:35104463-35104485 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094901039 12:35117367-35117389 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094901183 12:35119743-35119765 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094901270 12:35121101-35121123 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094901353 12:35122460-35122482 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094901602 12:35126536-35126558 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094901687 12:35127895-35127917 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094901770 12:35129254-35129276 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094901857 12:35130613-35130635 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094901940 12:35131972-35131994 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094902023 12:35133331-35133353 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094902112 12:35134690-35134712 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094902196 12:35136049-35136071 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094902279 12:35137406-35137428 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094902515 12:35141143-35141165 TTCCAAGGAAGGCCTCAAAGAGG - Intergenic
1094902536 12:35141483-35141505 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094902964 12:35148266-35148288 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094903029 12:35149288-35149310 TTCCCACGAAGGCCTCAAAGAGG - Intergenic
1094903215 12:35152343-35152365 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094903548 12:35157776-35157798 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094903633 12:35159135-35159157 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094903949 12:35164229-35164251 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094904161 12:35167626-35167648 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094904411 12:35171706-35171728 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094904580 12:35174422-35174444 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094904747 12:35177140-35177162 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094904957 12:35180539-35180561 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094905335 12:35186652-35186674 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094905380 12:35187333-35187355 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094905610 12:35191066-35191088 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094905714 12:35192764-35192786 TTCCAAGGAAGGCCTCAAAGAGG - Intergenic
1094905778 12:35193783-35193805 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094905868 12:35195142-35195164 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094905931 12:35196158-35196180 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094906305 12:35202274-35202296 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094906390 12:35203633-35203655 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094906474 12:35204993-35205015 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094906558 12:35206352-35206374 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094907065 12:35214501-35214523 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094907150 12:35215861-35215883 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094907400 12:35219939-35219961 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094907570 12:35222654-35222676 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094907658 12:35224013-35224035 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094907745 12:35225373-35225395 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094908158 12:35232167-35232189 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094908698 12:35240995-35241017 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094908781 12:35242354-35242376 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094908965 12:35245410-35245432 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094909099 12:35247448-35247470 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094909268 12:35250169-35250191 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094909666 12:35256621-35256643 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094910133 12:35264095-35264117 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094910175 12:35264775-35264797 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094910347 12:35267494-35267516 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094910451 12:35269192-35269214 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094910603 12:35271571-35271593 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094910687 12:35272930-35272952 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094910748 12:35273949-35273971 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094911058 12:35279046-35279068 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094911225 12:35281767-35281789 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094911269 12:35282446-35282468 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094911389 12:35284483-35284505 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094911543 12:35286862-35286884 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094911709 12:35289580-35289602 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094911793 12:35290938-35290960 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094912043 12:35295011-35295033 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094912213 12:35297725-35297747 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094912298 12:35299084-35299106 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094912346 12:35299764-35299786 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094912506 12:35302479-35302501 TTCCAACGAAGGACTCAAAGAGG - Intergenic
1094912585 12:35303838-35303860 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094912668 12:35305197-35305219 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094912753 12:35306557-35306579 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094912836 12:35307917-35307939 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094912922 12:35309272-35309294 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094913098 12:35311991-35312013 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094913264 12:35314709-35314731 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094913350 12:35316068-35316090 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094913514 12:35318785-35318807 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094913743 12:35322521-35322543 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094914013 12:35326937-35326959 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094914344 12:35332374-35332396 TTCCAACGAAGGACTCAAAGAGG - Intergenic
1094915023 12:35343579-35343601 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094915070 12:35344259-35344281 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094915337 12:35348676-35348698 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094915588 12:35352751-35352773 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094915941 12:35358519-35358541 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094915961 12:35358859-35358881 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094916044 12:35360219-35360241 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094916252 12:35363618-35363640 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094916337 12:35364977-35364999 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094916422 12:35366336-35366358 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094916508 12:35367694-35367716 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094916594 12:35369053-35369075 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094916763 12:35371771-35371793 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094917486 12:35383321-35383343 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094917552 12:35384340-35384362 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094917572 12:35384680-35384702 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094917742 12:35387398-35387420 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094917931 12:35390454-35390476 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094917954 12:35390794-35390816 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094917995 12:35391473-35391495 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094918080 12:35392833-35392855 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094918395 12:35397928-35397950 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094918850 12:35405399-35405421 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094919107 12:35409475-35409497 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094919445 12:35414909-35414931 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094919507 12:35415928-35415950 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094919594 12:35417287-35417309 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094919681 12:35418646-35418668 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094919767 12:35420006-35420028 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094919891 12:35422045-35422067 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094919978 12:35423405-35423427 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094920062 12:35424764-35424786 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094920208 12:35427142-35427164 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094920512 12:35432229-35432251 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094920717 12:35435626-35435648 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094920901 12:35438681-35438703 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094921319 12:35445478-35445500 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094921406 12:35446837-35446859 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094922079 12:35457712-35457734 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094922246 12:35460426-35460448 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094922374 12:35462467-35462489 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094922458 12:35463826-35463848 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094922775 12:35468924-35468946 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094922955 12:35471983-35472005 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094923121 12:35474701-35474723 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094923451 12:35480134-35480156 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094923595 12:35482511-35482533 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094923895 12:35487268-35487290 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094924167 12:35491686-35491708 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094924504 12:35497118-35497140 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094924589 12:35498477-35498499 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094924673 12:35499836-35499858 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094924759 12:35501190-35501212 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094924930 12:35503908-35503930 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094925223 12:35508664-35508686 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094925332 12:35510363-35510385 TTCCAAGGAAGGCCTCAAAGAGG - Intergenic
1094925426 12:35511892-35511914 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094925590 12:35514611-35514633 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094925675 12:35515970-35515992 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094925823 12:35518348-35518370 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094925846 12:35518688-35518710 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094925934 12:35520048-35520070 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094926018 12:35521408-35521430 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094926427 12:35528193-35528215 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094926781 12:35533959-35533981 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094927094 12:35539054-35539076 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094927303 12:35542452-35542474 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094927593 12:35547205-35547227 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094927890 12:35551960-35551982 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094927909 12:35552300-35552322 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094928163 12:35556377-35556399 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094928378 12:35559775-35559797 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094928415 12:35560454-35560476 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094928658 12:35564192-35564214 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094929059 12:35570647-35570669 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094929310 12:35574725-35574747 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094929496 12:35577783-35577805 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094929628 12:35579822-35579844 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094929840 12:35583215-35583237 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094930170 12:35588649-35588671 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094930336 12:35591367-35591389 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094930423 12:35592726-35592748 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094930632 12:35596123-35596145 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094930716 12:35597482-35597504 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094931046 12:35602915-35602937 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094931359 12:35608007-35608029 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094931448 12:35609366-35609388 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094931595 12:35611744-35611766 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094931679 12:35613103-35613125 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094931767 12:35614462-35614484 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094931851 12:35615820-35615842 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094931936 12:35617181-35617203 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094932252 12:35622276-35622298 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094932437 12:35625333-35625355 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094932457 12:35625673-35625695 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094932517 12:35626692-35626714 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094932694 12:35629747-35629769 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094933449 12:35641969-35641991 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094933617 12:35644687-35644709 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094933701 12:35646047-35646069 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094933789 12:35647405-35647427 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094933958 12:35650123-35650145 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094934120 12:35652814-35652836 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094934430 12:35657897-35657919 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094934598 12:35660614-35660636 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094934729 12:35662653-35662675 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094934813 12:35664012-35664034 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094934900 12:35665372-35665394 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094935321 12:35672167-35672189 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094935697 12:35678284-35678306 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094935793 12:35679982-35680004 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094935878 12:35681341-35681363 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094936466 12:35690850-35690872 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094936680 12:35694247-35694269 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094936771 12:35695605-35695627 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094937057 12:35700358-35700380 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094937135 12:35701719-35701741 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094937221 12:35703079-35703101 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094937305 12:35704438-35704460 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094938176 12:35718706-35718728 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094938306 12:35720746-35720768 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094938392 12:35722105-35722127 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094938518 12:35724144-35724166 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094938564 12:35724824-35724846 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094938609 12:35725504-35725526 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094938651 12:35726183-35726205 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094938876 12:35729916-35729938 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094939086 12:35733309-35733331 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094939132 12:35733989-35734011 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094939399 12:35738403-35738425 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094939439 12:35739082-35739104 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094939524 12:35740441-35740463 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094939606 12:35741800-35741822 TTCCAACGAAGGTCCCAAAGAGG - Intergenic
1094939941 12:35747237-35747259 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094940107 12:35749955-35749977 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094940314 12:35753352-35753374 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094940780 12:35760822-35760844 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094940870 12:35762180-35762202 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094940954 12:35763539-35763561 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094941164 12:35766936-35766958 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094941249 12:35768295-35768317 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094941873 12:35778483-35778505 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094942157 12:35783239-35783261 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094942198 12:35783918-35783940 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094942365 12:35786636-35786658 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094942540 12:35789356-35789378 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094942793 12:35793433-35793455 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094943047 12:35797516-35797538 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094943253 12:35800909-35800931 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094943508 12:35804988-35805010 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094944026 12:35813484-35813506 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094944191 12:35816204-35816226 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094944253 12:35817224-35817246 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094944339 12:35818583-35818605 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094944506 12:35821301-35821323 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094944679 12:35824019-35824041 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094944932 12:35828097-35828119 TTCCAAGGAAGGCCTCAAAGAGG - Intergenic
1094945181 12:35832173-35832195 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094945225 12:35832853-35832875 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094945348 12:35834891-35834913 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094945390 12:35835570-35835592 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094945598 12:35838966-35838988 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094945689 12:35840321-35840343 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094945922 12:35844052-35844074 TTCCAAGGAAGGCCTCAAAGAGG - Intergenic
1094946031 12:35845751-35845773 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094946447 12:35852542-35852564 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094946532 12:35853900-35853922 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094946739 12:35857297-35857319 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094946882 12:35859675-35859697 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094947197 12:35864768-35864790 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094947219 12:35865108-35865130 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094947396 12:35867825-35867847 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094947564 12:35870544-35870566 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094947645 12:35871903-35871925 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094947689 12:35872583-35872605 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094948019 12:35878022-35878044 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094948144 12:35880061-35880083 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094948392 12:35884141-35884163 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094948435 12:35884821-35884843 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094948602 12:35887540-35887562 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094948689 12:35888899-35888921 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094948937 12:35892975-35892997 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094949444 12:35901465-35901487 TTCCAAGGAAGGCCTCAAAGAGG - Intergenic
1094949487 12:35902143-35902165 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094950065 12:35911320-35911342 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094950150 12:35912679-35912701 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094950315 12:35915397-35915419 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094950418 12:35917095-35917117 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094950683 12:35921509-35921531 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094950853 12:35924227-35924249 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094951069 12:35927964-35927986 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094951154 12:35929323-35929345 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094951238 12:35930682-35930704 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094951302 12:35931701-35931723 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094951469 12:35934420-35934442 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094951981 12:35942565-35942587 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094952274 12:35947322-35947344 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094952902 12:35957515-35957537 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094952963 12:35958532-35958554 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094953129 12:35961252-35961274 TTCCAATGAAGGCCCCAAAGAGG - Intergenic
1094953628 12:35969067-35969089 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094953804 12:35971781-35971803 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094954312 12:35979935-35979957 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094954395 12:35981294-35981316 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094955008 12:35991143-35991165 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094955254 12:35995220-35995242 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094955496 12:35999295-35999317 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094955581 12:36000654-36000676 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094955667 12:36002014-36002036 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094955918 12:36006088-36006110 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094956396 12:36013903-36013925 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094956500 12:36015601-36015623 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094956545 12:36016281-36016303 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094957116 12:36025453-36025475 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094957201 12:36026812-36026834 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094957287 12:36028171-36028193 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094957372 12:36029530-36029552 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094957622 12:36033607-36033629 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094957709 12:36034965-36034987 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094957985 12:36039378-36039400 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094958074 12:36040737-36040759 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094958315 12:36044814-36044836 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094958359 12:36045494-36045516 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094958380 12:36045834-36045856 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094958527 12:36048214-36048236 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094958611 12:36049574-36049596 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094958740 12:36051616-36051638 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094958828 12:36052975-36052997 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094959062 12:36056709-36056731 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094959103 12:36057388-36057410 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094959229 12:36059427-36059449 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094959353 12:36061464-36061486 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094959396 12:36062144-36062166 TTCCAACGAAGGACTCAAAGAGG - Intergenic
1094959418 12:36062485-36062507 TTCCCACGAAGGCCTCAAAGAGG - Intergenic
1094959438 12:36062825-36062847 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094959600 12:36065540-36065562 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094959724 12:36067580-36067602 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094959890 12:36070298-36070320 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094960142 12:36074375-36074397 TTCCAAGGAAGGCCTCAAAGAGG - Intergenic
1094960184 12:36075054-36075076 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094960268 12:36076413-36076435 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094960356 12:36077773-36077795 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094960459 12:36079469-36079491 TTCCAACGAAGGACTCAAAGAGG - Intergenic
1094960669 12:36082865-36082887 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094960710 12:36083544-36083566 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094960876 12:36086257-36086279 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094961132 12:36090331-36090353 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094961385 12:36094408-36094430 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094961513 12:36096447-36096469 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094962100 12:36105961-36105983 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094962270 12:36108680-36108702 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094962581 12:36113772-36113794 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094962666 12:36115132-36115154 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094962977 12:36120227-36120249 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094963312 12:36125665-36125687 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094963396 12:36127024-36127046 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094963522 12:36129063-36129085 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094963607 12:36130422-36130444 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094963736 12:36132461-36132483 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094963939 12:36135854-36135876 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094964026 12:36137209-36137231 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094964072 12:36137889-36137911 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094964381 12:36142988-36143010 TTCCAACGAAGGACCCAAAGAGG - Intergenic
1094964883 12:36151145-36151167 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094964927 12:36151826-36151848 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094964970 12:36152505-36152527 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094965057 12:36153864-36153886 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094965187 12:36155903-36155925 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094965273 12:36157262-36157284 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094965397 12:36159300-36159322 TTCCAACGAAGGACTCAAAGAGG - Intergenic
1094965729 12:36164736-36164758 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094965897 12:36167456-36167478 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094966071 12:36170174-36170196 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094966242 12:36172893-36172915 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094966659 12:36179683-36179705 TTCCAAGGAAGGCCTCAAAGAGG - Intergenic
1094966742 12:36181043-36181065 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094966827 12:36182403-36182425 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094966913 12:36183759-36183781 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094967006 12:36185117-36185139 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094967052 12:36185797-36185819 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094967094 12:36186478-36186500 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094967180 12:36187838-36187860 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094967685 12:36195994-36196016 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094967848 12:36198712-36198734 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094967936 12:36200071-36200093 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094968480 12:36208903-36208925 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094968561 12:36210258-36210280 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094968643 12:36211617-36211639 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094968982 12:36217049-36217071 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094969444 12:36224520-36224542 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094969594 12:36226899-36226921 TTCCAACGAAGGCCCCAAAGTGG - Intergenic
1094969685 12:36228259-36228281 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094969725 12:36228938-36228960 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094969813 12:36230297-36230319 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094969897 12:36231657-36231679 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094970438 12:36240491-36240513 TTCCAACGAAGGACTCAAAGAGG - Intergenic
1094970592 12:36242863-36242885 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094970700 12:36244562-36244584 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094970743 12:36245242-36245264 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094971014 12:36249658-36249680 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094971488 12:36257470-36257492 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094971573 12:36258832-36258854 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094971659 12:36260190-36260212 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094972277 12:36270046-36270068 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094972423 12:36272425-36272447 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094972595 12:36275139-36275161 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094972678 12:36276500-36276522 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094972724 12:36277180-36277202 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094972934 12:36280579-36280601 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094973019 12:36281938-36281960 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094973101 12:36283297-36283319 TTCCCACGAAGGCCTCAAAGAGG - Intergenic
1094973567 12:36290771-36290793 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094973695 12:36292807-36292829 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094973925 12:36296540-36296562 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094974092 12:36299259-36299281 TTCCAACGAAGGACTCAAAGAGG - Intergenic
1094974137 12:36299939-36299961 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094974405 12:36304347-36304369 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094974491 12:36305706-36305728 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094974660 12:36308425-36308447 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094974724 12:36309442-36309464 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094974807 12:36310802-36310824 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094974895 12:36312162-36312184 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094974981 12:36313522-36313544 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094975067 12:36314883-36314905 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094975599 12:36323380-36323402 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094975832 12:36327120-36327142 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094975876 12:36327800-36327822 TTCCAATGAAGGCCCCAAAGAGG - Intergenic
1094975940 12:36328818-36328840 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094975963 12:36329158-36329180 TTCCAACGAAGGCCTCATAGAGG - Intergenic
1094976025 12:36330173-36330195 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094976275 12:36334243-36334265 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094976607 12:36339675-36339697 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094976716 12:36341375-36341397 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094976761 12:36342055-36342077 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094976803 12:36342734-36342756 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094976990 12:36345784-36345806 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094977077 12:36347139-36347161 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094977164 12:36348498-36348520 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094977544 12:36354612-36354634 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094978046 12:36362769-36362791 TTCCAATGAAGGCCCCAAAGAGG - Intergenic
1094978109 12:36363787-36363809 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094978441 12:36369227-36369249 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094978778 12:36374664-36374686 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094979291 12:36382823-36382845 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094980037 12:36395052-36395074 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094980119 12:36396410-36396432 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094980284 12:36399128-36399150 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094980616 12:36404565-36404587 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094980824 12:36407965-36407987 TTCCAACGAAGGACTCAAAGAGG - Intergenic
1094981594 12:36420535-36420557 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094981842 12:36424611-36424633 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094981887 12:36425289-36425311 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094982181 12:36430048-36430070 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094982263 12:36431407-36431429 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094982681 12:36438201-36438223 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094982847 12:36440919-36440941 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094982929 12:36442278-36442300 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094982970 12:36442958-36442980 TTCCAACGAAGGACTCAAAGAGG - Intergenic
1094983593 12:36453151-36453173 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094983678 12:36454510-36454532 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094984094 12:36461310-36461332 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094984563 12:36468784-36468806 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094984584 12:36469124-36469146 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094984670 12:36470483-36470505 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094984757 12:36471843-36471865 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094985011 12:36475921-36475943 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094985266 12:36479999-36480021 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094985434 12:36482719-36482741 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094985516 12:36484078-36484100 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094985563 12:36484758-36484780 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094986108 12:36493595-36493617 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094986155 12:36494270-36494292 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094986446 12:36499026-36499048 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094986597 12:36501405-36501427 TTCCAACGAAGGACTCAAAGAGG - Intergenic
1094986700 12:36503104-36503126 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094987943 12:36523490-36523512 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094988113 12:36526211-36526233 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094988532 12:36533004-36533026 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094988736 12:36536401-36536423 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094988883 12:36538780-36538802 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094989192 12:36543879-36543901 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094989216 12:36544219-36544241 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094989278 12:36545239-36545261 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094989633 12:36551015-36551037 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094990117 12:36558827-36558849 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094990206 12:36560182-36560204 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094990291 12:36561541-36561563 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094990377 12:36562899-36562921 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094990423 12:36563579-36563601 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094990625 12:36566975-36566997 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094990710 12:36568336-36568358 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094990874 12:36571053-36571075 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094991351 12:36578865-36578887 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094991435 12:36580224-36580246 TTCCAATGAAGGCCCCAAAGAGG - Intergenic
1094991496 12:36581243-36581265 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094991725 12:36584974-36584996 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094992063 12:36590406-36590428 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094992128 12:36591425-36591447 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094992388 12:36595504-36595526 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094992557 12:36598218-36598240 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094992642 12:36599578-36599600 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094992808 12:36602297-36602319 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094992887 12:36603654-36603676 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094993104 12:36607047-36607069 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094993150 12:36607728-36607750 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094993358 12:36611122-36611144 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094993524 12:36613842-36613864 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094993610 12:36615201-36615223 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094993780 12:36617918-36617940 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094993865 12:36619276-36619298 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094994037 12:36621997-36622019 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094994372 12:36627433-36627455 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094994544 12:36630149-36630171 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094994632 12:36631510-36631532 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094994717 12:36632869-36632891 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094995052 12:36638303-36638325 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094995518 12:36645782-36645804 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094995540 12:36646118-36646140 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094995625 12:36647477-36647499 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094995857 12:36651215-36651237 TTCCCACGAAGGCCTCAAAGAGG - Intergenic
1094995877 12:36651555-36651577 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094995980 12:36653254-36653276 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094996206 12:36656992-36657014 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094996287 12:36658352-36658374 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094996373 12:36659711-36659733 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094996537 12:36662429-36662451 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094996954 12:36669224-36669246 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094997121 12:36671943-36671965 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094997341 12:36675191-36675213 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094997380 12:36675870-36675892 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094997462 12:36677229-36677251 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094997631 12:36679944-36679966 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094997788 12:36682321-36682343 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094997872 12:36683680-36683702 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094998436 12:36692849-36692871 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094998605 12:36695568-36695590 TTCCAACGAAGGCCCCAAAGTGG - Intergenic
1094998691 12:36696927-36696949 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094999025 12:36702327-36702349 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094999465 12:36709460-36709482 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1094999914 12:36716938-36716960 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095000253 12:36722377-36722399 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095000419 12:36725098-36725120 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095000503 12:36726459-36726481 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095000777 12:36730873-36730895 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095000862 12:36732231-36732253 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095001189 12:36737659-36737681 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095001274 12:36739018-36739040 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095001614 12:36744453-36744475 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095001778 12:36747172-36747194 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095001822 12:36747854-36747876 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095001861 12:36748531-36748553 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095002109 12:36752609-36752631 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095002195 12:36753968-36753990 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095002509 12:36759059-36759081 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095002843 12:36764497-36764519 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095002911 12:36765516-36765538 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095003344 12:36772651-36772673 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095003429 12:36774010-36774032 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095003699 12:36778427-36778449 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095003786 12:36779787-36779809 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095003872 12:36781287-36781309 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095004206 12:36786719-36786741 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095004460 12:36790797-36790819 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095004790 12:36796235-36796257 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095005140 12:36801772-36801794 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095005225 12:36803132-36803154 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095005308 12:36804486-36804508 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095005727 12:36811275-36811297 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095005917 12:36814332-36814354 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095006082 12:36817049-36817071 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095006167 12:36818408-36818430 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095006338 12:36821128-36821150 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095006790 12:36828603-36828625 TTCCAACGAAGGACTCAAAGAGG - Intergenic
1095006939 12:36830981-36831003 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095006998 12:36831999-36832021 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095007292 12:36836755-36836777 TTCCAACGAAGGCCCCAAAGTGG - Intergenic
1095007335 12:36837435-36837457 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095007735 12:36843890-36843912 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095008177 12:36851022-36851044 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095008431 12:36855100-36855122 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095008634 12:36858475-36858497 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095008761 12:36860512-36860534 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095008851 12:36861872-36861894 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095009432 12:36871387-36871409 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095009602 12:36874105-36874127 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095010281 12:36885312-36885334 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095010406 12:36887352-36887374 TTCCAACGAAGGTCCCAAAGAGG - Intergenic
1095010488 12:36888712-36888734 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095010531 12:36889392-36889414 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095010573 12:36890071-36890093 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095010808 12:36893808-36893830 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095010870 12:36894828-36894850 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095010995 12:36896868-36896890 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095011096 12:36898564-36898586 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095011495 12:36905017-36905039 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095011678 12:36908075-36908097 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095011764 12:36909435-36909457 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095011849 12:36910794-36910816 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095012064 12:36914194-36914216 TTCCAAGGAAGGCCTCAAAGAGG - Intergenic
1095012835 12:36926754-36926776 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095012983 12:36929132-36929154 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095013156 12:36931852-36931874 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095013242 12:36933209-36933231 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095013454 12:36936603-36936625 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095013496 12:36937282-36937304 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095013809 12:36942372-36942394 TTCCAACGAAGGACTCAAAGAGG - Intergenic
1095013930 12:36944406-36944428 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095014097 12:36947124-36947146 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095014206 12:36948823-36948845 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095014251 12:36949503-36949525 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095014310 12:36950521-36950543 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095014565 12:36954599-36954621 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095014737 12:36957317-36957339 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095015078 12:36962741-36962763 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095015164 12:36964100-36964122 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095015568 12:36970699-36970721 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095015843 12:36975110-36975132 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095016092 12:36979188-36979210 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095016180 12:36980547-36980569 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095016598 12:36987340-36987362 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095016684 12:36988700-36988722 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095017044 12:36994478-36994500 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095017380 12:36999913-36999935 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095017462 12:37001272-37001294 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095017717 12:37005351-37005373 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095018028 12:37010445-37010467 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095018236 12:37013838-37013860 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095018610 12:37019948-37019970 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095018776 12:37022663-37022685 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095019784 12:37038963-37038985 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095020037 12:37043040-37043062 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095020546 12:37051197-37051219 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095020873 12:37056629-37056651 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095021213 12:37062067-37062089 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095021297 12:37063424-37063446 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095021469 12:37066143-37066165 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095021515 12:37066823-37066845 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095021639 12:37068861-37068883 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095021825 12:37071920-37071942 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095021885 12:37072940-37072962 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095021972 12:37074299-37074321 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095021993 12:37074639-37074661 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095022353 12:37080413-37080435 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095022581 12:37084145-37084167 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095022667 12:37085503-37085525 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095022752 12:37086862-37086884 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095023251 12:37095004-37095026 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095023332 12:37096363-37096385 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095023499 12:37099077-37099099 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095023584 12:37100435-37100457 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095023829 12:37104518-37104540 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095023997 12:37107237-37107259 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095024151 12:37109612-37109634 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095024676 12:37118104-37118126 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095024765 12:37119463-37119485 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095025024 12:37123537-37123559 TTTCCAGGAAGGCCTCAAAGAGG - Intergenic
1095025147 12:37125575-37125597 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095025230 12:37126935-37126957 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095025316 12:37128294-37128316 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095025399 12:37129652-37129674 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095025484 12:37131011-37131033 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095025816 12:37136450-37136472 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095025981 12:37139168-37139190 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095026068 12:37140527-37140549 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095026239 12:37143242-37143264 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095026600 12:37149017-37149039 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095026853 12:37153096-37153118 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095027102 12:37157170-37157192 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095027125 12:37157511-37157533 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095027297 12:37160228-37160250 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095027382 12:37161588-37161610 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095027465 12:37162946-37162968 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095027548 12:37164305-37164327 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095027631 12:37165664-37165686 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095027717 12:37167023-37167045 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095027799 12:37168382-37168404 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095027883 12:37169741-37169763 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095028140 12:37173818-37173840 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095028270 12:37175858-37175880 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1095028556 12:37180613-37180635 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1096555590 12:52401574-52401596 CTCCCAGGGAGGACTCATCGCGG - Intronic
1101739981 12:107493186-107493208 TTCCCTGCAAGGACCCTGAGTGG - Intronic
1101825400 12:108216602-108216624 TTGCCAAGATGCACCCATAGGGG + Intronic
1102349969 12:112184844-112184866 TCACCAGGAAGGACCCACAGGGG - Exonic
1103310845 12:120006591-120006613 TTCTCAGGAAGGAACCTTTGGGG + Intronic
1103455885 12:121064873-121064895 TTCCCAGGAAGAACAAAAAGCGG + Intergenic
1103503056 12:121419964-121419986 CTCTCAGGAAGGTCCCATAATGG - Intronic
1104880252 12:132065692-132065714 CTCCCAGGGAAGACCCAAAGTGG - Intronic
1104892523 12:132147436-132147458 ATCCCAGGATGGCCCCGTAGTGG + Intronic
1106086998 13:26551637-26551659 TGCCCAGGAAGGCTCCAGAGAGG + Intergenic
1107943516 13:45396381-45396403 TCCCAAGGAAGGATGCATAGTGG - Intronic
1108066797 13:46586291-46586313 TGCCCAGGAAGGTCTCACAGAGG + Intronic
1114000781 14:18241655-18241677 TTCCCACGAAGGCCTCAAAGCGG + Intergenic
1114257049 14:21012046-21012068 TTCCCAGCAAGGAGCCAGAGAGG + Intergenic
1117211639 14:53506950-53506972 TTTCCAGGAAGGCCACAAAGAGG - Intergenic
1118786233 14:69047573-69047595 TCCCCAGGAGGGACACATAGAGG + Intergenic
1119892211 14:78191506-78191528 TTCCCAGGGAGGACCCCTGCAGG + Intergenic
1120546646 14:85820163-85820185 TTCCCTGGCCGGACTCATAGAGG + Intergenic
1121408038 14:93730898-93730920 TTCCCAGGGAGGAGCCATATTGG + Intronic
1121998979 14:98630375-98630397 TGCCCAGCAAGGAGGCATAGTGG + Intergenic
1123385704 15:19798681-19798703 TTCCAACGAAGGCCTCATAGTGG + Intergenic
1129746592 15:78026013-78026035 TTCCAAGGAAGGATCCAGTGGGG - Intronic
1130186541 15:81688917-81688939 TTCCCAGGCAGGAACCTAAGGGG + Intergenic
1130885542 15:88089775-88089797 TTCCCATGAAGCAGCCAGAGTGG + Intronic
1131033680 15:89207071-89207093 TTCTGAGGAAGAAGCCATAGGGG - Intergenic
1132994633 16:2816852-2816874 TTCCCAAGAAGGTCCCATGAAGG + Intergenic
1133358121 16:5151967-5151989 TTCCCACCAAGGACTCAAAGTGG - Intergenic
1136920937 16:34273405-34273427 TTCCAAGGAAGGCCTCAAAGAGG - Intergenic
1136921020 16:34274762-34274784 TTCCAAGGAAGGCCTCAAAGAGG - Intergenic
1137021576 16:35433079-35433101 TTCCTAGGTGGGAGCCATAGAGG - Intergenic
1137098255 16:36338802-36338824 TTCCAAGGAAGGCCTCAAAGAGG - Intergenic
1137098775 16:36347291-36347313 TTCCAAGGAAGGCCTCAAAGAGG - Intergenic
1137099323 16:36356448-36356470 TTCCAAGGAAGGCCTCAAAGAGG - Intergenic
1137108070 16:36501527-36501549 TTCCAAGGAAGGCCTCAAAGAGG - Intergenic
1137118691 16:36677250-36677272 TTCCAACGAAGGACTCAAAGAGG - Intergenic
1137136134 16:36966662-36966684 TTCCAAGGAAGGCCTCAAAGAGG - Intergenic
1137142603 16:37073663-37073685 TTCCAAGGAAGGCCTCAAAGAGG - Intergenic
1137142953 16:37079442-37079464 TTCCAAGGAAGGCCTCAAAGAGG - Intergenic
1137154161 16:37264520-37264542 TTCCAAGGAAGGCCTCAAAGAGG - Intergenic
1137177117 16:37644334-37644356 TTCCAAGGAAGGCCTCAAAGAGG - Intergenic
1137182272 16:37729598-37729620 TTCCAAAGAAGGACTCAAAGAGG - Intergenic
1137189659 16:37852214-37852236 TTCCAAGGAAGGCCTCAAAGAGG - Intergenic
1137189964 16:37857309-37857331 TTCCAAGGAAGGCCTCAAAGAGG - Intergenic
1137191073 16:37875654-37875676 TTCCAAGGAAGGCCTCAAAGAGG - Intergenic
1137191286 16:37879050-37879072 TTCCAAGGAAGGCCTCAAAGAGG - Intergenic
1137192555 16:37900107-37900129 TTCCAAGGAAGGCCTCAAAGAGG - Intergenic
1137202986 16:38072290-38072312 TTCCAAGGAAGGCCTCAAAGAGG - Intergenic
1137207620 16:38148389-38148411 TTCCAAGGAAGGCCTCAAAGAGG - Intergenic
1137209569 16:38180670-38180692 TTCCAAGGAAGGCCTCAAAGAGG - Intergenic
1138160529 16:54749040-54749062 ATCCCAGGAAGCACCTGTAGAGG + Intergenic
1142914786 17:3127452-3127474 TGAACAGGAAGGACCCAAAGAGG + Exonic
1144654277 17:17025378-17025400 GTCCCAGGAAACACCAATAGAGG + Intergenic
1145475555 17:23604035-23604057 TTCGAAGGAAGGACACAGAGTGG - Intergenic
1145482411 17:23703623-23703645 TTCGCACGAAGGACACAGAGTGG - Intergenic
1145506390 17:24053101-24053123 TTCGAAGGAAGGACACAGAGTGG - Intergenic
1145537090 17:24499440-24499462 TTCGCACGAAGGACACAGAGTGG - Intergenic
1145537275 17:24502157-24502179 TTCCAACGAAGGACACAGAGTGG - Intergenic
1145548568 17:24666506-24666528 TTCAAACGAAGGACACATAGTGG - Intergenic
1145583919 17:25180311-25180333 TTCGCACGAAGGACACAGAGTGG - Intergenic
1145591386 17:25288554-25288576 TTCGAAGGAAGGACACAGAGTGG - Intergenic
1145593709 17:25322479-25322501 TTCGCACGAAGGACACAGAGTGG - Intergenic
1145636305 17:25942552-25942574 TTCGAAGGAAGGACACAGAGTGG - Intergenic
1145684724 17:26640191-26640213 TTCCAACGAAGGACTCAAAGTGG - Intergenic
1145684839 17:26641835-26641857 TTCCAACGAAGGCCTCATAGCGG - Intergenic
1145688784 17:26709783-26709805 TTCCAAGGAAGGCCTCAAAGCGG - Intergenic
1147316515 17:39623440-39623462 GTCCCAGGAAACACCCTTAGAGG - Intergenic
1149568649 17:57656766-57656788 TCCCCAGGAAGGCTCCCTAGAGG + Intronic
1149851652 17:60039891-60039913 TTCCTGGGAGGGACCCATGGGGG + Intergenic
1150229018 17:63539741-63539763 TTTCCAGGAAGGACCCAAAGAGG - Intronic
1150492439 17:65583842-65583864 TTCCCAGGAGGAAGCCAGAGGGG - Intronic
1152363316 17:79842257-79842279 TTCCCAGGAAGGGCCCTCTGGGG - Intergenic
1155818177 18:30342883-30342905 ATGCCAGGAAGGTCCTATAGTGG - Intergenic
1160889832 19:1371382-1371404 TTCCCAGGACTGACCCACCGAGG - Intronic
1164345025 19:27242456-27242478 TTCCAACGAAGGACCCTAAGAGG - Intergenic
1166128727 19:40732571-40732593 TTACCAGCCAGGAACCATAGAGG + Intronic
1166255019 19:41597753-41597775 TTCCCAGGACTGACCACTAGAGG - Intronic
1166266923 19:41690303-41690325 TTCAAAGGTAGGACCCAGAGAGG + Intronic
1168314705 19:55479607-55479629 TTCACAGGACGGCCCCACAGCGG - Intronic
925299875 2:2804179-2804201 ATCCCAGGAAGGAGCAACAGAGG + Intergenic
926434432 2:12824050-12824072 ATCCTGGAAAGGACCCATAGAGG - Intergenic
927811001 2:26180093-26180115 TTCCCAGGAGGGTCCCAGGGCGG + Intronic
928371070 2:30740655-30740677 TTCCCACGAAGGCCCCCTATGGG + Intronic
928429048 2:31202747-31202769 GTCTCAAGAAGGACCCATTGTGG + Intronic
931633625 2:64322808-64322830 TTCCCAGGAAGCTCCCTCAGGGG - Intergenic
932086359 2:68765987-68766009 TTCACAGGAAGGACCCTTCCAGG - Intronic
932615108 2:73226666-73226688 TCCTCAGGAGGGACACATAGTGG + Exonic
932971278 2:76545962-76545984 TTCTCAGGTAGGATCCACAGAGG + Intergenic
933892121 2:86781595-86781617 CTTCCAGGAAGGACTCCTAGAGG - Intergenic
933941107 2:87245875-87245897 GTCCCAGGGAAGACCCCTAGGGG + Intergenic
934947367 2:98551563-98551585 TTCCCAGGGAAGTCCCAAAGTGG - Intronic
936352034 2:111720137-111720159 GTCCCAGGGAAGACCCCTAGGGG - Intergenic
938742006 2:134241281-134241303 TTCCCAGGAAGAAACCATAGTGG - Intronic
942314996 2:174689902-174689924 TTCCCAGGAAAGTCCCATTAGGG - Intergenic
946869138 2:224070229-224070251 ATCTCAGGAAGCATCCATAGTGG - Intergenic
948036719 2:234863773-234863795 ACCCCAGGAAGGGCCCACAGGGG + Intergenic
1171401388 20:24874926-24874948 CTTCCTGGAAGGACCCAGAGAGG + Intergenic
1171574001 20:26282090-26282112 TTCCAACGAAGGCCCCAAAGCGG - Intergenic
1172205547 20:33160447-33160469 TTCCCAGGAGCCTCCCATAGTGG - Intergenic
1172312610 20:33930064-33930086 ATCCCAGGAAGTACCAGTAGGGG - Intergenic
1173177839 20:40777861-40777883 GTCCCAGGAAGCACCAGTAGGGG + Intergenic
1174664076 20:52240851-52240873 ATCCCAGGAAACACCCATAAAGG + Intergenic
1175417060 20:58808673-58808695 TGCCCAGACAGGACCCCTAGTGG - Intergenic
1179089707 21:38253188-38253210 CTCCCAGGAGGAACCCAAAGTGG - Intronic
1179569682 21:42271127-42271149 GGCCCCGGAAGGACCCATAATGG - Exonic
1180425293 22:15172453-15172475 TTCCCACGAAGGCCTCAAAGCGG + Intergenic
1180508156 22:16040210-16040232 TTCCAATGAAGGCCCCAAAGCGG + Intergenic
1180995437 22:19963087-19963109 TCCCCAGGCAGGTCCCATGGTGG - Intronic
1181135767 22:20765148-20765170 TTCCCAGCAAGGAGCCACTGCGG - Exonic
1181758669 22:25042796-25042818 ATCCCAGGAAGAACCAGTAGGGG + Intronic
1181921848 22:26326878-26326900 CTCCCCGGAAGGCCCCAGAGGGG - Intronic
1182782566 22:32880010-32880032 ATCCCAGGAAGGTCCCCCAGGGG - Intronic
1183000385 22:34852491-34852513 CTCCCAGGAAGGTTCCCTAGGGG + Intergenic
1183277000 22:36904809-36904831 TTCCCAGGTAAGACCCATAGAGG + Intergenic
1183353933 22:37348659-37348681 GTCCCAGGAAGGACACTCAGGGG + Intergenic
1184348245 22:43925940-43925962 TTCCCAGGCAGGACACAGGGAGG + Intronic
1184778211 22:46633721-46633743 ATCCCAGGAAGAATCCATTGTGG + Intronic
1185097273 22:48817619-48817641 TTCCCAGGAAGGACCCATAGGGG + Intronic
949164938 3:928368-928390 TTCCAAGCAAGGAATCATAGAGG - Intergenic
950231660 3:11281410-11281432 CTCCCAGGAAAGGCCCATATGGG - Intronic
951746718 3:25986397-25986419 TTCTCAGAATGGACCCAGAGTGG - Intergenic
952702798 3:36343777-36343799 TCCCCAAGAAGGCCCCATACAGG + Intergenic
953777574 3:45834738-45834760 TTCCTAGGAAAGACAGATAGTGG + Intronic
955905799 3:63806326-63806348 ATCCCAGGAAACACCCAGAGTGG - Intergenic
958209120 3:90445881-90445903 TTCCAACGAAGGACTCAAAGCGG + Intergenic
958209161 3:90446563-90446585 TTCCAACGAAGGACTCAAAGTGG + Intergenic
958209926 3:90459991-90460013 TTCCAATGAAGGACACAAAGCGG + Intergenic
958211978 3:90494703-90494725 TTCCAAGGAAGGCCTCAAAGAGG + Intergenic
958212469 3:90504905-90504927 TTCCAACGAAGGACTCAAAGAGG + Intergenic
958214083 3:90538316-90538338 TTCCAAGGAAGGCCACAAAGAGG + Intergenic
958214234 3:90541373-90541395 TTCCAAGGAAGGCCACAAAGAGG + Intergenic
958216984 3:90597049-90597071 TTCCAATGAAGGCCTCATAGTGG + Intergenic
958223886 3:90785319-90785341 TTCCCACGAAGGCCACAAAGAGG - Intergenic
958226252 3:90825244-90825266 TTCCCACGAAGGCCACAAAGAGG - Intergenic
958227071 3:90838839-90838861 TTCCCACGAAGGCCACAAAGAGG - Intergenic
958227177 3:90840540-90840562 TTCCCACGAAGGCCACAAAGAGG - Intergenic
958229220 3:90875370-90875392 TTCCCACGAAGGCCACAAAGAGG - Intergenic
958229527 3:90880467-90880489 TTCCCACGAAGGCCACAAAGAGG - Intergenic
958230941 3:90904253-90904275 TTCCCACGAAGGCCACAAAGAGG - Intergenic
958232054 3:90922946-90922968 TTCCCACGAAGGACACAAAAAGG - Intergenic
958232764 3:90934839-90934861 TTCCCACGAAGGCCACAAAGAGG - Intergenic
958233175 3:90941633-90941655 TTCCCACGAAGGCCACAAAGAGG - Intergenic
958233381 3:90945031-90945053 TTCCCACGAAGGCCACAAAGAGG - Intergenic
958234205 3:90958623-90958645 TTCCCACGAAGGCCACAAAGAGG - Intergenic
958235296 3:90977312-90977334 TTCCCACGAAGGCCACAAAGAGG - Intergenic
958236296 3:90994301-90994323 TTCCCACGAAGGCCACAAAGAGG - Intergenic
958237317 3:91011292-91011314 TTCCCACGAAGGCCACAAAGAGG - Intergenic
958237520 3:91014689-91014711 TTCCCACGAAGGCCACAAAGAGG - Intergenic
958239124 3:91041873-91041895 TTCCCACGAAGGCCACAAAGAGG - Intergenic
958239638 3:91050367-91050389 TTCCCACGAAGGCCACAAAGAGG - Intergenic
958241050 3:91074150-91074172 TTCCCACGAAGGCCACAAAGAGG - Intergenic
958241160 3:91075851-91075873 TTCCCACGAAGGCCACAAAGAGG - Intergenic
958242120 3:91091998-91092020 TTCCCACGAAGGCCACAAAGAGG - Intergenic
958242738 3:91102193-91102215 TTCACAGGAAGGCCACAAAGAGG - Intergenic
958243743 3:91119182-91119204 TTCCCACGAAGGCCACAAAGAGG - Intergenic
958244152 3:91125979-91126001 TTCCCACGAAGGCCACAAAGAGG - Intergenic
958245464 3:91148070-91148092 TTCCCACGAAGGCCACAAAGAGG - Intergenic
958245966 3:91156567-91156589 TTCCCACGAAGGCCACAAAGAGG - Intergenic
958246471 3:91165063-91165085 TTCCCACGAAGGCCACAAAGAGG - Intergenic
958246679 3:91168460-91168482 TTCCCACGAAGGCCACAAAGAGG - Intergenic
958247893 3:91188851-91188873 TTCCCACGAAGGCCACAAAGAGG - Intergenic
958250855 3:91238055-91238077 TTCCCACGAAGGCCACAAAGAGG - Intergenic
958250946 3:91239414-91239436 TTCCCACGAAGGCCACAAAGAGG - Intergenic
958251331 3:91245871-91245893 TTCCCACGAAGGCCACAAAGAGG - Intergenic
958272667 3:91524643-91524665 TTCCCAAGAAGGACTCAAAAAGG + Intergenic
958272702 3:91525323-91525345 TTCCAAGGAAGGCCTCAAAGAGG + Intergenic
958294559 3:91886093-91886115 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
958304341 3:92046260-92046282 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
958311144 3:92158040-92158062 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
958331470 3:92491022-92491044 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
958333239 3:92519938-92519960 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
958360862 3:92973324-92973346 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
958366975 3:93072830-93072852 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
958404556 3:93737617-93737639 TTCCCACGAAGGCCTCAAAGTGG + Intergenic
958404628 3:93738979-93739001 TTCCAATGAAGGACTCAAAGAGG + Intergenic
958405762 3:93757120-93757142 TTCCCACGAAGGCCTCAAAGCGG + Intergenic
960313209 3:116142302-116142324 TTCCCAGGAATGACCCACCTAGG + Intronic
961459165 3:127039349-127039371 TCTCCAGGAAGGCCCCAAAGGGG - Intergenic
962184521 3:133243923-133243945 TTCCCAGGAATAACTGATAGGGG + Intronic
962609585 3:137063122-137063144 TTCCCAGGAAAGACCCAGCCGGG - Intergenic
962755053 3:138460332-138460354 TTCCCAGGCAGAACCCCTACAGG - Intronic
962875782 3:139535224-139535246 CTCCCAGCAAGGACTCACAGAGG + Intronic
963046653 3:141107462-141107484 TGCCCTGGATGGACACATAGTGG - Intronic
963981090 3:151537862-151537884 TTCCCAGTAATTACCCACAGTGG + Intergenic
965428799 3:168561330-168561352 TTGCCAGGAATGCCCCATAAGGG + Intergenic
967564955 3:190962093-190962115 TTCCCAAGAAGTTCCCATCGAGG - Intergenic
968425284 4:519141-519163 TTCCCAGGAAGGAAAAGTAGAGG - Intronic
968480974 4:832896-832918 TGCCCAGCAAGGACCCCTGGGGG + Intergenic
969445120 4:7240356-7240378 TCCCCAGGAAGGACTCATCGAGG - Intronic
970228047 4:13880215-13880237 TTCCCAGATAGGAACCAGAGAGG + Intergenic
972256266 4:37358976-37358998 TTCCCAGGACACTCCCATAGTGG - Intronic
972805474 4:42525964-42525986 TTCTCAGGAAGGAGCCATGAGGG - Intronic
974850546 4:67399978-67400000 TTCCAACGAAGGACACAAAGAGG + Intergenic
978374034 4:108056731-108056753 TTCCCAGAAACGACACATATGGG + Intronic
979699453 4:123651499-123651521 TCCCCAGGAAGAAACCATTGAGG + Intergenic
985918419 5:2946228-2946250 TTCCCAGGAAGCTCCGATAAAGG + Intergenic
989900005 5:47157295-47157317 TTCCAAAGAAGGCCTCATAGAGG - Intergenic
989900164 5:47160016-47160038 TTCCAAAGAAGGCCTCATAGAGG - Intergenic
989900326 5:47162737-47162759 TTCCAAAGAAGGCCTCATAGAGG - Intergenic
989900489 5:47165458-47165480 TTCCAAAGAAGGCCTCATAGAGG - Intergenic
989900648 5:47168176-47168198 TTCCAAAGAAGGCCTCATAGAGG - Intergenic
989900817 5:47170896-47170918 TTCCAAAGAAGGCCACATAGAGG - Intergenic
989900979 5:47173617-47173639 TTCCAAAGAAGGCCTCATAGAGG - Intergenic
989901147 5:47176338-47176360 TTCCAAAGAAGGCCTCATAGAGG - Intergenic
989901311 5:47179059-47179081 TTCCAAAGAAGGCCTCATAGAGG - Intergenic
989901457 5:47181440-47181462 TTCCAAAGAAGGCCTCATAGAGG - Intergenic
989901623 5:47184160-47184182 TTCCAAAGAAGGCCTCATAGAGG - Intergenic
989901788 5:47186880-47186902 TTCCAAAGAAGGCCTCATAGAGG - Intergenic
989901953 5:47189602-47189624 TTCCAAAGAAGGCCTCATAGAGG - Intergenic
989902117 5:47192322-47192344 TTCCAAAGAAGGCCTCATAGAGG - Intergenic
989902279 5:47195041-47195063 TTCCAAAGAAGGCCTCATAGAGG - Intergenic
989902429 5:47197421-47197443 TTCCAAAGAAGGCCTCATAGAGG - Intergenic
989902597 5:47200141-47200163 TTCCAAAGAAGGCCTCATAGAGG - Intergenic
989902760 5:47202860-47202882 TTCCAAAGAAGGCCTCATAGAGG - Intergenic
989902930 5:47205579-47205601 TTCCAAAGAAGGCCTCATAGAGG - Intergenic
989903095 5:47208300-47208322 TTCCAAAGAAGGCCTCATAGAGG - Intergenic
989903317 5:47212036-47212058 TTCCAAAGAAGGCCTCATAGAGG - Intergenic
989903460 5:47214416-47214438 TTCCAAAGAAGGCCTCATAGAGG - Intergenic
989903657 5:47217817-47217839 TTCCAAAGAAGGCCTCATAGAGG - Intergenic
989903820 5:47220537-47220559 TTCCAAAGAAGGCCTCATAGAGG - Intergenic
989903968 5:47222916-47222938 TTCCAAAGAAGGCCTCATAGAGG - Intergenic
989904135 5:47225637-47225659 TTCCAAAGAAGGCCTCATAGAGG - Intergenic
989904313 5:47228524-47228546 TTCCAAAGAAGGCCTCATAGAGG - Intergenic
989904479 5:47231244-47231266 TTCCAAAGAAGGCCTCATAGAGG - Intergenic
989904640 5:47233965-47233987 TTCCAAAGAAGGCCTCATAGAGG - Intergenic
989904804 5:47236684-47236706 TTCCAAAGAAGGCCTCATAGAGG - Intergenic
989904973 5:47239403-47239425 TTCCAAAGAAGGCCTCATAGAGG - Intergenic
989905051 5:47240763-47240785 TTCCAAAGAAGGCCTCATAGAGG - Intergenic
989905215 5:47243482-47243504 TTCCAAAGAAGGCCTCATAGAGG - Intergenic
989905385 5:47246198-47246220 TTCCAAAGAAGGCCTCATAGAGG - Intergenic
989905535 5:47248578-47248600 TTCCAAAGAAGGCCTCATAGAGG - Intergenic
989905702 5:47251298-47251320 TTCCAAAGAAGGCCTCATAGAGG - Intergenic
989905870 5:47254017-47254039 TTCCAAAGAAGGCCTCATAGAGG - Intergenic
989906038 5:47256739-47256761 TTCCAAAGAAGGCCTCATAGAGG - Intergenic
989906367 5:47262179-47262201 TTCCAAAGAAGGCCTCATAGAGG - Intergenic
989906696 5:47267622-47267644 TTCCAAAGAAGGCCTCATAGAGG - Intergenic
989906868 5:47270344-47270366 TTCCAAAGAAGGCCTCATAGAGG - Intergenic
989907032 5:47273065-47273087 TTCCAAAGAAGGCCTCATAGAGG - Intergenic
989907195 5:47275784-47275806 TTCCAAAGAAGGCCTCATAGAGG - Intergenic
989907361 5:47278506-47278528 TTCCAAAGAAGGCCTCATAGAGG - Intergenic
989907524 5:47281226-47281248 TTCCAAAGAAGGCCACATAGAGG - Intergenic
989907686 5:47283944-47283966 TTCCAAAGAAGGCCTCATAGAGG - Intergenic
989907853 5:47286665-47286687 TTCCAAAGAAGGCCACATAGAGG - Intergenic
989908175 5:47292104-47292126 TTCCAAAGAAGGCCTCATAGAGG - Intergenic
989908339 5:47294824-47294846 TTCCAAAGAAGGCCTCATAGAGG - Intergenic
989908870 5:49591977-49591999 TTCCAAGGAAGGCCTCAAAGAGG - Intergenic
989909619 5:49613474-49613496 TTCCAAGGAAGGCCTCAAAGAGG + Intergenic
989909659 5:49614154-49614176 TTCCAAGGAAGGCCTCAAAGAGG + Intergenic
989909699 5:49614833-49614855 TTCCAAGGAAGGCCTCAAAGAGG + Intergenic
989910193 5:49626366-49626388 TTCCAACGAAGGACTCAAAGAGG + Intergenic
989910796 5:49647805-49647827 TTCCAAGGAAGGCCTCAAAGAGG - Intergenic
989919691 5:49783952-49783974 TTCCCATGAAGGCCTCAAAGTGG - Intergenic
989920284 5:49792810-49792832 TTCCCATGAAGGCCTCAAAGTGG - Intergenic
989927480 5:49898770-49898792 TTCCCATGAAGGCCTCAAAGTGG - Intergenic
989928369 5:49911885-49911907 TTCCTATGAAGGCCTCATAGTGG - Intergenic
989929263 5:49925165-49925187 TTCCCATGAAGGCCTCAAAGTGG - Intergenic
989931157 5:49953780-49953802 TTCCCATGAAGGCCTCAAAGTGG - Intergenic
989932207 5:49969281-49969303 TTCCCATGAAGGCCTCAGAGTGG - Intergenic
989934001 5:49995856-49995878 TTCCCATGAAGGCCTCAAAGTGG - Intergenic
989934154 5:49998071-49998093 TTCCCATGAAGGCCTCAAAGTGG - Intergenic
989936400 5:50031299-50031321 TTCCCATGAAGGCCTCAAAGTGG - Intergenic
989938353 5:50109918-50109940 TTCCCATGAAGGCCTCAAAGTGG + Intergenic
993870062 5:93242044-93242066 TTCCCAGGAATGAACACTAGTGG - Intergenic
996167219 5:120239241-120239263 TCCCTAGGAAGGAACCACAGAGG + Intergenic
997459205 5:134040877-134040899 TTCCCAGGAATTACACATGGAGG + Intergenic
1002312560 5:178323526-178323548 TCCCCAGGAAGGACCCTCTGCGG - Intronic
1002905499 6:1445623-1445645 ACCCCAGGAAGGTCCTATAGCGG - Intergenic
1006680941 6:35796375-35796397 TTCCCAGCCAAGACCCATGGTGG + Intronic
1009106586 6:59128710-59128732 TTCCAACGAAGGCCTCATAGAGG - Intergenic
1009254913 6:61375901-61375923 TTCCAAAGAAGGCCCCAAAGAGG - Intergenic
1009255391 6:61386100-61386122 TTCCAAGGAAGGTCTCAAAGAGG - Intergenic
1009255654 6:61392384-61392406 TTCCAACGAAGGACTCAAAGAGG - Intergenic
1011416183 6:87122482-87122504 TGCCCAGGAAGGCCTCATGGCGG + Intergenic
1014079185 6:117268506-117268528 CTGCTGGGAAGGACCCATAGGGG + Intronic
1016809685 6:148247845-148247867 TTCCCAGGGAGGGGCCAGAGTGG - Intergenic
1018195542 6:161353464-161353486 ATCCCAGGAAGTCTCCATAGAGG + Intronic
1019541525 7:1553822-1553844 GTCCCAGGCAGGACACAGAGTGG - Intronic
1020035457 7:4960501-4960523 TTCCCGGGCAGGTCCCATAGGGG - Intergenic
1020351333 7:7222005-7222027 CACCAAGGAAGGTCCCATAGAGG - Intronic
1023694294 7:42828954-42828976 TTCTCAAGAAGTAACCATAGTGG + Intergenic
1024042528 7:45566427-45566449 TTCTCAGGAAGGACACTTTGTGG - Intergenic
1025428473 7:60038439-60038461 TTCCAAGGAAGGCCTCAAAGCGG - Intergenic
1025473103 7:60883431-60883453 TTCCAACGAAGGACTCAAAGTGG + Intergenic
1025513902 7:61606435-61606457 TTCCAACGAAGGACTCAAAGTGG - Intergenic
1025537170 7:61963839-61963861 TTCCCACGAAGGCCTCAAAGCGG - Intergenic
1025538246 7:62035275-62035297 TTCCAACGAAGGACTCAAAGTGG - Intergenic
1025568581 7:62524050-62524072 TTCCAATGAAGGACTCTTAGAGG - Intergenic
1029575064 7:101397954-101397976 TGCCCAGGTAGGCCCCCTAGAGG + Intronic
1030079794 7:105767407-105767429 TTCCCAGAGAGGACGCATGGCGG - Intronic
1034414925 7:150959373-150959395 GGCCCAGGATGGACACATAGGGG - Intronic
1039471233 8:37814926-37814948 GTCCCAGGAAGGAGCCATTGCGG - Exonic
1040143033 8:43948742-43948764 TTCCAACGAAGGCCTCATAGAGG - Intergenic
1040143522 8:43958478-43958500 TTCCAACGAAGGACTCAAAGAGG - Intergenic
1040271693 8:45954945-45954967 TTCCAACGAAGGCCTCATAGAGG - Intergenic
1040272226 8:45965706-45965728 TTCCAACGAAGGACTCAAAGAGG - Intergenic
1046695223 8:117332403-117332425 TTTCCAGTAATGACCCAAAGGGG - Intergenic
1048901449 8:139041739-139041761 CCCCCAGGAAGGAGCTATAGGGG + Intergenic
1053609919 9:39701777-39701799 TTCCCTGGAAGAATCCATCGGGG - Intergenic
1053712796 9:40838900-40838922 TTCCAACGAAGGCCTCATAGCGG - Intergenic
1053867981 9:42460009-42460031 TTCCCTGGAAGAATCCATCGGGG - Intergenic
1053938490 9:43198242-43198264 TTCCAAGGAAGGACTCTAAGTGG - Intergenic
1054025723 9:44679938-44679960 TTCCAACGAAGGCCCCAAAGAGG - Intergenic
1054423325 9:64972148-64972170 TTCCAACGAAGGCCTCATAGCGG - Intergenic
1054557728 9:66675163-66675185 TTCCCTGGAAGAATCCATCGGGG + Intergenic
1056189767 9:84173280-84173302 TTCCCAAGAAGCACCACTAGGGG - Intergenic
1057190633 9:93085173-93085195 TTCCAAGCAAGGACCCATGGAGG + Intergenic
1057617575 9:96605570-96605592 ATCCCAGGAAGCACTCACAGGGG - Intronic
1059660642 9:116396755-116396777 TACCCAGGAAGGACTCACATTGG + Exonic
1059909114 9:119022723-119022745 TTCCCATAAAGGGCCCATAAAGG - Intergenic
1061921405 9:133784470-133784492 TTCCCAGGATGGCCACATGGTGG - Intronic
1061956127 9:133962141-133962163 TGCCCAGGAGGGTCCCATAGAGG - Intronic
1062121715 9:134837371-134837393 ATCCCACGAAGGACCCTTGGAGG + Intronic
1062515177 9:136929864-136929886 TTTCCAAGAAGGTCCCATAATGG + Intronic
1203354823 Un_KI270442v1:124997-125019 TTCCAACGAAGGCCTCATAGCGG + Intergenic
1186654763 X:11600778-11600800 TTCCCAGGAAACACCAGTAGGGG + Intronic
1189700947 X:43716005-43716027 CTTCCAGGAATGACCCACAGGGG + Intronic
1191274655 X:58528059-58528081 TTCCAAGGAAGGCCTCAAAGTGG - Intergenic
1191274917 X:58532938-58532960 TTCCAACGAAGGCCCCAAAGCGG + Intergenic
1200217856 X:154376423-154376445 TTCCCAGGAAGAACCCCCTGAGG + Intergenic