ID: 1185103547

View in Genome Browser
Species Human (GRCh38)
Location 22:48854532-48854554
Sequence CCTAACATGCACAGGCTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185103547_1185103551 17 Left 1185103547 22:48854532-48854554 CCTTTGAGCCTGTGCATGTTAGG No data
Right 1185103551 22:48854572-48854594 TCCACTCACATTGCTTAATCTGG No data
1185103547_1185103554 27 Left 1185103547 22:48854532-48854554 CCTTTGAGCCTGTGCATGTTAGG No data
Right 1185103554 22:48854582-48854604 TTGCTTAATCTGGGAGCTGAAGG No data
1185103547_1185103553 18 Left 1185103547 22:48854532-48854554 CCTTTGAGCCTGTGCATGTTAGG No data
Right 1185103553 22:48854573-48854595 CCACTCACATTGCTTAATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185103547 Original CRISPR CCTAACATGCACAGGCTCAA AGG (reversed) Intergenic
No off target data available for this crispr