ID: 1185105953

View in Genome Browser
Species Human (GRCh38)
Location 22:48869967-48869989
Sequence TGGTGCACACGCAGCCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185105948_1185105953 7 Left 1185105948 22:48869937-48869959 CCCTTCTTCCAGGATAGCACACG No data
Right 1185105953 22:48869967-48869989 TGGTGCACACGCAGCCATCTTGG No data
1185105949_1185105953 6 Left 1185105949 22:48869938-48869960 CCTTCTTCCAGGATAGCACACGT No data
Right 1185105953 22:48869967-48869989 TGGTGCACACGCAGCCATCTTGG No data
1185105951_1185105953 -1 Left 1185105951 22:48869945-48869967 CCAGGATAGCACACGTGATGGTT No data
Right 1185105953 22:48869967-48869989 TGGTGCACACGCAGCCATCTTGG No data
1185105947_1185105953 8 Left 1185105947 22:48869936-48869958 CCCCTTCTTCCAGGATAGCACAC No data
Right 1185105953 22:48869967-48869989 TGGTGCACACGCAGCCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185105953 Original CRISPR TGGTGCACACGCAGCCATCT TGG Intergenic
No off target data available for this crispr