ID: 1185106134

View in Genome Browser
Species Human (GRCh38)
Location 22:48871034-48871056
Sequence CCGGGGGCACGCCATTATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185106134_1185106141 -7 Left 1185106134 22:48871034-48871056 CCATCATAATGGCGTGCCCCCGG No data
Right 1185106141 22:48871050-48871072 CCCCCGGAATCAGGGGGCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185106134 Original CRISPR CCGGGGGCACGCCATTATGA TGG (reversed) Intergenic
No off target data available for this crispr