ID: 1185107175

View in Genome Browser
Species Human (GRCh38)
Location 22:48880037-48880059
Sequence CTGGAGTTCAAGGGCAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185107175_1185107178 -6 Left 1185107175 22:48880037-48880059 CCAGTTTTGCCCTTGAACTCCAG No data
Right 1185107178 22:48880054-48880076 CTCCAGTGTGTCTCACATAATGG No data
1185107175_1185107180 4 Left 1185107175 22:48880037-48880059 CCAGTTTTGCCCTTGAACTCCAG No data
Right 1185107180 22:48880064-48880086 TCTCACATAATGGTTCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185107175 Original CRISPR CTGGAGTTCAAGGGCAAAAC TGG (reversed) Intergenic
No off target data available for this crispr