ID: 1185107175 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 22:48880037-48880059 |
| Sequence | CTGGAGTTCAAGGGCAAAAC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1185107175_1185107178 | -6 | Left | 1185107175 | 22:48880037-48880059 | CCAGTTTTGCCCTTGAACTCCAG | No data | ||
| Right | 1185107178 | 22:48880054-48880076 | CTCCAGTGTGTCTCACATAATGG | No data | ||||
| 1185107175_1185107180 | 4 | Left | 1185107175 | 22:48880037-48880059 | CCAGTTTTGCCCTTGAACTCCAG | No data | ||
| Right | 1185107180 | 22:48880064-48880086 | TCTCACATAATGGTTCATCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1185107175 | Original CRISPR | CTGGAGTTCAAGGGCAAAAC TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||