ID: 1185108691

View in Genome Browser
Species Human (GRCh38)
Location 22:48888690-48888712
Sequence ACGGCATCCCTGATCCAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185108691_1185108692 -6 Left 1185108691 22:48888690-48888712 CCTTACTGGATCAGGGATGCCGT No data
Right 1185108692 22:48888707-48888729 TGCCGTCCTGATTGCAGCTGTGG No data
1185108691_1185108696 11 Left 1185108691 22:48888690-48888712 CCTTACTGGATCAGGGATGCCGT No data
Right 1185108696 22:48888724-48888746 CTGTGGAAACAAAGGCAGCAAGG No data
1185108691_1185108697 16 Left 1185108691 22:48888690-48888712 CCTTACTGGATCAGGGATGCCGT No data
Right 1185108697 22:48888729-48888751 GAAACAAAGGCAGCAAGGCTTGG No data
1185108691_1185108695 3 Left 1185108691 22:48888690-48888712 CCTTACTGGATCAGGGATGCCGT No data
Right 1185108695 22:48888716-48888738 GATTGCAGCTGTGGAAACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185108691 Original CRISPR ACGGCATCCCTGATCCAGTA AGG (reversed) Intergenic
No off target data available for this crispr