ID: 1185108693

View in Genome Browser
Species Human (GRCh38)
Location 22:48888709-48888731
Sequence TTCCACAGCTGCAATCAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185108693_1185108699 27 Left 1185108693 22:48888709-48888731 CCGTCCTGATTGCAGCTGTGGAA No data
Right 1185108699 22:48888759-48888781 CTCCTGAATCCCAGAGTCTGTGG No data
1185108693_1185108697 -3 Left 1185108693 22:48888709-48888731 CCGTCCTGATTGCAGCTGTGGAA No data
Right 1185108697 22:48888729-48888751 GAAACAAAGGCAGCAAGGCTTGG No data
1185108693_1185108696 -8 Left 1185108693 22:48888709-48888731 CCGTCCTGATTGCAGCTGTGGAA No data
Right 1185108696 22:48888724-48888746 CTGTGGAAACAAAGGCAGCAAGG No data
1185108693_1185108700 28 Left 1185108693 22:48888709-48888731 CCGTCCTGATTGCAGCTGTGGAA No data
Right 1185108700 22:48888760-48888782 TCCTGAATCCCAGAGTCTGTGGG No data
1185108693_1185108702 29 Left 1185108693 22:48888709-48888731 CCGTCCTGATTGCAGCTGTGGAA No data
Right 1185108702 22:48888761-48888783 CCTGAATCCCAGAGTCTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185108693 Original CRISPR TTCCACAGCTGCAATCAGGA CGG (reversed) Intergenic
No off target data available for this crispr