ID: 1185108696

View in Genome Browser
Species Human (GRCh38)
Location 22:48888724-48888746
Sequence CTGTGGAAACAAAGGCAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185108693_1185108696 -8 Left 1185108693 22:48888709-48888731 CCGTCCTGATTGCAGCTGTGGAA No data
Right 1185108696 22:48888724-48888746 CTGTGGAAACAAAGGCAGCAAGG No data
1185108691_1185108696 11 Left 1185108691 22:48888690-48888712 CCTTACTGGATCAGGGATGCCGT No data
Right 1185108696 22:48888724-48888746 CTGTGGAAACAAAGGCAGCAAGG No data
1185108690_1185108696 12 Left 1185108690 22:48888689-48888711 CCCTTACTGGATCAGGGATGCCG No data
Right 1185108696 22:48888724-48888746 CTGTGGAAACAAAGGCAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185108696 Original CRISPR CTGTGGAAACAAAGGCAGCA AGG Intergenic
No off target data available for this crispr