ID: 1185109934

View in Genome Browser
Species Human (GRCh38)
Location 22:48895159-48895181
Sequence CAGACTCCTGGCCACGGGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 164}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185109919_1185109934 24 Left 1185109919 22:48895112-48895134 CCCCGGCGCCTTCCACCTGGGCA 0: 1
1: 0
2: 0
3: 8
4: 194
Right 1185109934 22:48895159-48895181 CAGACTCCTGGCCACGGGGGCGG 0: 1
1: 0
2: 1
3: 20
4: 164
1185109920_1185109934 23 Left 1185109920 22:48895113-48895135 CCCGGCGCCTTCCACCTGGGCAG 0: 1
1: 0
2: 3
3: 18
4: 298
Right 1185109934 22:48895159-48895181 CAGACTCCTGGCCACGGGGGCGG 0: 1
1: 0
2: 1
3: 20
4: 164
1185109926_1185109934 -3 Left 1185109926 22:48895139-48895161 CCATGTGCACCCTCAGGCTTCAG 0: 1
1: 0
2: 7
3: 26
4: 296
Right 1185109934 22:48895159-48895181 CAGACTCCTGGCCACGGGGGCGG 0: 1
1: 0
2: 1
3: 20
4: 164
1185109921_1185109934 22 Left 1185109921 22:48895114-48895136 CCGGCGCCTTCCACCTGGGCAGC 0: 1
1: 0
2: 2
3: 38
4: 298
Right 1185109934 22:48895159-48895181 CAGACTCCTGGCCACGGGGGCGG 0: 1
1: 0
2: 1
3: 20
4: 164
1185109922_1185109934 16 Left 1185109922 22:48895120-48895142 CCTTCCACCTGGGCAGCTGCCAT 0: 1
1: 0
2: 3
3: 35
4: 359
Right 1185109934 22:48895159-48895181 CAGACTCCTGGCCACGGGGGCGG 0: 1
1: 0
2: 1
3: 20
4: 164
1185109923_1185109934 12 Left 1185109923 22:48895124-48895146 CCACCTGGGCAGCTGCCATGTGC 0: 1
1: 0
2: 1
3: 38
4: 428
Right 1185109934 22:48895159-48895181 CAGACTCCTGGCCACGGGGGCGG 0: 1
1: 0
2: 1
3: 20
4: 164
1185109924_1185109934 9 Left 1185109924 22:48895127-48895149 CCTGGGCAGCTGCCATGTGCACC 0: 1
1: 0
2: 4
3: 31
4: 256
Right 1185109934 22:48895159-48895181 CAGACTCCTGGCCACGGGGGCGG 0: 1
1: 0
2: 1
3: 20
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185109934 Original CRISPR CAGACTCCTGGCCACGGGGG CGG Intergenic
900412977 1:2521438-2521460 CAGAATCCTGGGCAAGAGGGAGG + Intronic
900474015 1:2867976-2867998 CAGCCTCCTGGCCAGGGGGAAGG + Intergenic
900489873 1:2942539-2942561 CTGGCACCTGGCCAAGGGGGAGG - Intergenic
900606883 1:3527688-3527710 CAGACTCATGCCCACTGGGCAGG + Intronic
901361365 1:8703429-8703451 CAGACTCCCCGCGACGGCGGCGG + Intronic
901815174 1:11789676-11789698 CAGCCTGATGGCCAAGGGGGTGG - Exonic
901930542 1:12594148-12594170 CAGATTACTGTCCACCGGGGTGG + Intronic
902362693 1:15950792-15950814 GAGACTCCTAGCCAAGGGGAGGG + Intronic
904445776 1:30571968-30571990 CAGACTGCTGGGAACTGGGGAGG - Intergenic
907406983 1:54259668-54259690 CAGCCGCCTGCCCACTGGGGAGG + Intronic
910963289 1:92784474-92784496 CCGACTTCTGGCCTCGAGGGTGG + Intronic
912796039 1:112694212-112694234 CAGACTTCTGACCCCAGGGGAGG + Intronic
912879265 1:113391475-113391497 CAGACTCCTTGACGAGGGGGAGG + Intronic
916438754 1:164801258-164801280 CAGACAGCAGGCCACGGGTGAGG - Intronic
917686004 1:177416703-177416725 CAGCTTCCTGGCCTCAGGGGAGG + Intergenic
922726054 1:227923598-227923620 CAGACGCCTGGCCACGGAGAGGG + Intronic
923261707 1:232273943-232273965 CAGGCTCCTGGGCACCTGGGAGG + Intergenic
1064179252 10:13100395-13100417 CAGGCTCCGGGCCGCGGGGCAGG - Intronic
1065804313 10:29380803-29380825 CAGACTCCTGGGGAGGAGGGAGG + Intergenic
1065944872 10:30597217-30597239 CAGACTCCTGGGGAGGAGGGAGG - Intergenic
1067773208 10:49142273-49142295 CAGACTCCTGTGCAGGTGGGAGG - Intergenic
1068686026 10:59870616-59870638 CAGACTCCTGGACAGGTAGGTGG + Intronic
1069879961 10:71585978-71586000 CAGACTCCTGCCCATGGGGAGGG - Intronic
1070801340 10:79246193-79246215 CAGAGTGCTGGCCAAGGGGTTGG - Intronic
1074699837 10:116083262-116083284 CAGACTCCTGGCTCCGGGAAGGG - Intronic
1075574699 10:123570077-123570099 CAGAGGCCTGCCCACTGGGGTGG + Intergenic
1075777254 10:124996907-124996929 CAGACTCCAGGCGTCGGGCGAGG + Intronic
1076130362 10:128009871-128009893 CTGACTCCTGGCCATGGAGGGGG - Intronic
1076747096 10:132519957-132519979 CTGCCTCCTGGCCCCGGGGCTGG - Intergenic
1077258218 11:1598986-1599008 CACACTCATCGCCAAGGGGGTGG + Intergenic
1077438417 11:2556013-2556035 CAGACTCCTGGACAGGCAGGGGG - Intronic
1080121409 11:28682064-28682086 CTGACTCCTGGACAGGGTGGAGG + Intergenic
1081867508 11:46367636-46367658 CTGACTCCTAGCCACGGGATGGG - Exonic
1083651183 11:64205842-64205864 CAGAGTCCTGCCAATGGGGGAGG - Intergenic
1083878123 11:65535434-65535456 AAGACTCCTGGCCCTGGAGGAGG - Intronic
1084056632 11:66638210-66638232 CAGCGTCCTGGCCGCGAGGGGGG + Intronic
1084176629 11:67425727-67425749 CAGACACCAGGCCAGTGGGGTGG - Intergenic
1084980314 11:72825349-72825371 CAGCCTCCTGGCCACTGGAGGGG + Exonic
1087175489 11:95091268-95091290 CAGCCTCCTGTCCACTGGTGTGG - Intronic
1090259433 11:125308134-125308156 GAGACCCCTGGCCACTGGGATGG + Intronic
1104613643 12:130250777-130250799 CACACTGCTGGCAAAGGGGGAGG - Intergenic
1104949404 12:132432347-132432369 CAGACTCCTGGCCCCAGGCTGGG + Intergenic
1107821069 13:44286154-44286176 CAGAGTCATGGCCAAGGGGGAGG - Intergenic
1108575054 13:51783273-51783295 CAGATTTCAGGCCACAGGGGAGG - Intronic
1109968711 13:69737353-69737375 CAGCCTCCTTCCCACGGGAGTGG - Intronic
1113652447 13:112044491-112044513 CAGACTCGTGGGCATGGGGTGGG + Intergenic
1120759088 14:88270218-88270240 CAGACTTCAGGCCGCTGGGGAGG + Intronic
1121446277 14:93981161-93981183 CAGACTGCAGGGCATGGGGGAGG + Intergenic
1121607926 14:95254818-95254840 CACACACCTGGCTACTGGGGAGG - Intronic
1121791885 14:96704938-96704960 GAGACTCGTGGCCAGGAGGGAGG + Intergenic
1122544960 14:102517104-102517126 CAGCGCCCTGGCCCCGGGGGCGG + Intergenic
1122716456 14:103699433-103699455 CAGATGCCTGGCCCTGGGGGCGG + Exonic
1124023536 15:25944642-25944664 CGGCCTCCTGGCCACGCTGGAGG - Intergenic
1125340455 15:38670394-38670416 CAGACTGGTGGCCACAGGGTAGG + Intergenic
1129379144 15:75154542-75154564 CAGACTGCTGGGCATGGGAGGGG - Intergenic
1129472388 15:75762878-75762900 CATCCACCTGGCCCCGGGGGAGG - Intergenic
1129712246 15:77826289-77826311 CAGCCTCCTCGCCAGGGGGAGGG - Intergenic
1130228230 15:82076393-82076415 CAGACTCCTCACCAGGTGGGAGG - Intergenic
1132552726 16:560084-560106 CAGCCTGCGGGCAACGGGGGCGG + Intergenic
1132881928 16:2166106-2166128 CCGACTCCTGTCCAGTGGGGAGG - Intronic
1135256308 16:20944366-20944388 CAGCCTCCTGGCCAAGGGCAGGG - Intronic
1136587372 16:31195900-31195922 CAAACTCCTGGCCTCAGGTGAGG - Intergenic
1138398980 16:56730382-56730404 CCGACTCCAAGCCTCGGGGGCGG - Intronic
1139513190 16:67438864-67438886 TGTACTCCTGGCCAGGGGGGTGG + Exonic
1140474205 16:75230612-75230634 CTGACTCCTAGGCACGGGAGTGG - Intronic
1140944175 16:79752212-79752234 CACACTCCTGGTCAAGGGGAGGG + Intergenic
1140972179 16:80023959-80023981 CAGACGTCTGGCCAGAGGGGTGG + Intergenic
1141076066 16:81007338-81007360 CAGATCCCAGGCCTCGGGGGTGG + Intronic
1141617868 16:85220493-85220515 CAGGCTCCTGGCCGCGGGCCCGG - Intergenic
1142007610 16:87697166-87697188 CAGGCTACTGCCCACTGGGGTGG - Exonic
1142310219 16:89307827-89307849 AACACTCCTGGCCCAGGGGGTGG + Intronic
1143492855 17:7294249-7294271 CTGACTCCGGGCCGGGGGGGCGG + Exonic
1144732663 17:17537489-17537511 CAGGCTGCTGGGCACGGGGATGG - Intronic
1145780090 17:27557108-27557130 CAGAAACCTGGCCCAGGGGGTGG + Intronic
1147274966 17:39308271-39308293 CAAACTCCTGGCCATGGGCCAGG - Intronic
1147510690 17:41066445-41066467 CAGATCCCTGGCCACTGGTGTGG + Intergenic
1147864417 17:43543354-43543376 CAGACCCCTGGCCAAGGGGTGGG + Intronic
1148210462 17:45805564-45805586 GAGACACCTGGCCATGGGGTTGG + Intronic
1148854105 17:50569344-50569366 CAGAACCCTGGCCCCGGGGAAGG - Intronic
1149588081 17:57806970-57806992 AAGAATCCTGGCTACGGGGGAGG - Intergenic
1149639073 17:58191564-58191586 CAGGCTGCTGGCCACAGTGGTGG + Intergenic
1150204336 17:63390581-63390603 TATACTCCTGGCTACTGGGGAGG - Intronic
1151303299 17:73244852-73244874 CAGACACCTGGCCATGGGTGAGG + Intronic
1151448976 17:74185858-74185880 CATGCTCCTGGCCAGGGGGAAGG + Intergenic
1152602931 17:81274200-81274222 CAGGCACCTGGGCACGGGTGAGG - Intronic
1152905684 17:82969586-82969608 CAAACTCCTGGCCTCAGGCGAGG - Intronic
1153658476 18:7305867-7305889 CAGAGTTCTGGCCAATGGGGTGG + Intergenic
1158616029 18:58987836-58987858 CAGCCTCCTGGGCACGTGGGAGG - Intergenic
1160685678 19:435495-435517 CAGCCTGCTGGTCACGAGGGAGG - Intronic
1161320474 19:3638514-3638536 CAGACTCTTGGCCCCTCGGGAGG - Intronic
1163277323 19:16293512-16293534 CAAACACCCGGCCACGGGAGGGG - Intergenic
1165494789 19:36146127-36146149 CTGACTCCTGGGCATGGGAGTGG + Intronic
1166794864 19:45420071-45420093 CGGACTCCTGGGTCCGGGGGAGG - Intronic
1167548614 19:50144180-50144202 AAGACTCCTGGTCACGGAAGGGG + Intergenic
925412611 2:3648591-3648613 CGGACTCCTGGCCACAGGGAAGG + Intergenic
928085121 2:28341207-28341229 CAGCTTCCTTGCCACAGGGGAGG + Intergenic
931515874 2:63050540-63050562 CCGAGTCCTGGCCGCGGAGGGGG - Intronic
938017051 2:127876012-127876034 CAAATTCCTGGCCACAAGGGAGG + Intronic
938139220 2:128782711-128782733 CAGGCCCCTGGCCACTGGCGAGG - Intergenic
938177761 2:129151801-129151823 CAAACTCCTGGCCAGGTGTGGGG - Intergenic
939170446 2:138689316-138689338 CAGACTCCTGGCCCCAGAGGAGG + Intronic
946619248 2:221543808-221543830 AAAAGTCCTGGTCACGGGGGTGG + Intronic
947735045 2:232449962-232449984 CAGCCTCCTGGCCCCTGAGGAGG + Intergenic
948302070 2:236914961-236914983 CACACACCTGGCCAAGGTGGTGG - Intergenic
948456296 2:238106100-238106122 CTGACTCCTGGCCTTGGTGGTGG + Intronic
1169140092 20:3222898-3222920 CAGTCTGCAGGCCACGGGCGGGG + Intronic
1171435050 20:25115913-25115935 CAGACTCCCGGCCCCGGGGCTGG + Intergenic
1172756569 20:37289572-37289594 CAGAAACCTGGCAACGCGGGCGG + Intergenic
1173227545 20:41170696-41170718 CAGACTGCAGGCCACTGGTGAGG + Intronic
1173699345 20:45054274-45054296 CAGACTCCTGGCCAGGTGCGGGG + Intronic
1173863636 20:46300208-46300230 CAACCTCCTGGCCTGGGGGGTGG + Intronic
1175676779 20:60953024-60953046 CAGAGTCCCGGCCAAGGGGAGGG - Intergenic
1175921823 20:62453691-62453713 CAGACCCCAGGGCAGGGGGGTGG + Intergenic
1176057430 20:63156022-63156044 CAGGCTCCTGGCCACTGCGGAGG - Intergenic
1176370740 21:6060190-6060212 CAGCCACCTGGCCAAGGGGCAGG - Intergenic
1177594284 21:23215424-23215446 AAGACTCATGACCACTGGGGAGG - Intergenic
1179752779 21:43478351-43478373 CAGCCACCTGGCCAAGGGGCAGG + Intergenic
1184029542 22:41883846-41883868 CAGTCTCCTTGCCTCAGGGGAGG - Intronic
1184094360 22:42308657-42308679 CTCACTTCTGGCCATGGGGGAGG - Intronic
1184514753 22:44955142-44955164 CAGAGTCCTGGCCTCGGAGGAGG + Intronic
1184519502 22:44984451-44984473 CAGACTCCTGGACCCAGTGGTGG + Intronic
1185109934 22:48895159-48895181 CAGACTCCTGGCCACGGGGGCGG + Intergenic
1185226868 22:49658222-49658244 CAGACTGATGGCCTCTGGGGTGG + Intergenic
953037437 3:39225365-39225387 CAGACCCCTGTCCAGGGGGATGG + Intergenic
953492890 3:43365053-43365075 CAGGCACAAGGCCACGGGGGAGG - Intronic
954291013 3:49650060-49650082 CAGACTCCTGGGGCCAGGGGAGG - Intronic
954786662 3:53098446-53098468 CAGAAGCCTGGCCATGGGGTGGG - Intronic
961446485 3:126983768-126983790 CAGACCTCTGGCCGCGGGCGAGG + Intergenic
961810301 3:129518267-129518289 CATCCTCCTGGCCAAGGGGCAGG - Intronic
962308892 3:134312240-134312262 CAGACTCCTGGCCTGGAGGAAGG - Intergenic
962495519 3:135935748-135935770 CTGCCTCCTGGCCACTGGTGTGG + Intergenic
962808160 3:138941290-138941312 CAGACTCCTGGCTTCTGGGTGGG - Intergenic
963195982 3:142530838-142530860 CAGACTACTGGCTACAGGGAAGG - Intronic
966940875 3:184746332-184746354 CAGACTCCTGGCCTGGGGGGTGG - Intergenic
966974378 3:185071607-185071629 CGGACTCCAGGCCCCCGGGGTGG + Intergenic
968449127 4:666920-666942 CAGTGTGCTGGCCACGGCGGAGG - Intronic
968585020 4:1412319-1412341 CAGTCTCGGGGGCACGGGGGCGG - Intergenic
968641313 4:1716475-1716497 CAGACTCCTGGGTAGGGGTGGGG - Exonic
970426533 4:15950942-15950964 TAGACTCCTGCCCATGGGGCAGG + Intergenic
976547268 4:86350636-86350658 CATACTTCTGGCCAGGTGGGTGG - Intronic
977400095 4:96521337-96521359 CAGCCACCTGCCCACGGGGCAGG + Intergenic
983130302 4:164011185-164011207 CAGACTCCTGGACATTGGTGTGG + Intronic
985791027 5:1926810-1926832 CGGACCCCTGGCCATGGGGGAGG - Intergenic
993728818 5:91398554-91398576 CAATCTCCTGCCCAAGGGGGTGG - Intergenic
994252659 5:97555150-97555172 CACTCTCCTAGCAACGGGGGTGG + Intergenic
1001242407 5:170080587-170080609 CAAACTTCTGGCCCCTGGGGAGG - Intronic
1001245873 5:170105764-170105786 CAGCCTCCAGCCCACGGGGAGGG - Intergenic
1002334285 5:178467331-178467353 GAGGCTGCTGGCCAAGGGGGTGG - Intronic
1005946872 6:30601977-30601999 GATGGTCCTGGCCACGGGGGAGG - Exonic
1006442276 6:34060040-34060062 CAGACTCCAGGGCTGGGGGGTGG + Intronic
1006747846 6:36357430-36357452 CAGTCTCCTGGCCACAGAGCAGG + Intronic
1012586033 6:100923533-100923555 CAAACTCCTGTCCTCAGGGGAGG - Intergenic
1017750806 6:157488828-157488850 CAAACTCCTGGGAAGGGGGGCGG - Intronic
1018898581 6:168038785-168038807 CAGCCTCCTGACCAGGTGGGAGG - Intronic
1019078439 6:169410783-169410805 CTGAATCCTGGGCACTGGGGAGG - Intergenic
1023799329 7:43819829-43819851 CACACACCTGGCCAAGGGAGGGG - Intergenic
1024247244 7:47479768-47479790 CAGAAGCCTGGCCACAGGCGGGG - Intronic
1032461113 7:132112222-132112244 CAGATTCCTGGCTGCTGGGGAGG + Intergenic
1032637299 7:133723710-133723732 TAGACTCCTGGCCTCGGGTAAGG + Intronic
1033876255 7:145822472-145822494 CAGGCTCCTGGGGATGGGGGAGG + Intergenic
1036796413 8:11759400-11759422 CAGAGTCCTGGTCAGGGGGCAGG + Exonic
1037471416 8:19215155-19215177 CAGCCTCCTTCCCACGGTGGTGG - Intergenic
1040382073 8:46882653-46882675 CAAAGTCCTGGCCACAGAGGGGG - Intergenic
1041813801 8:61943233-61943255 CAGATTACTGGCCCAGGGGGAGG - Intergenic
1042964886 8:74339728-74339750 CACCCTCTTGGCCACAGGGGAGG + Intronic
1049349588 8:142157425-142157447 CAGGCTCCGGGCCACAGGCGTGG - Intergenic
1049587198 8:143437587-143437609 CATACTCCTGCCCAGAGGGGCGG + Intergenic
1053299985 9:36942105-36942127 CAGGCTCCTGGACACGCAGGTGG - Intronic
1054450629 9:65401870-65401892 CAGACTCCTGGCGAGTGGGACGG + Intergenic
1057282950 9:93726071-93726093 TAGACTCCTGGACAAAGGGGAGG + Intergenic
1059366007 9:113786850-113786872 CAGACTCCTGGACATGCGGGTGG - Intergenic
1061227745 9:129290623-129290645 CAGCCTCCTGGCCAAGCGGGAGG + Intergenic
1061441766 9:130609478-130609500 GCTCCTCCTGGCCACGGGGGAGG - Intronic
1061863357 9:133478980-133479002 CTGTCCCCTGGCGACGGGGGCGG + Exonic
1062248225 9:135581027-135581049 CCCACTGCTGGCCACAGGGGAGG - Intergenic
1062436899 9:136550423-136550445 CAGAGTCCTGGCCACAGCTGGGG - Intergenic
1185509516 X:652581-652603 TAGACTCCAGGCAACTGGGGAGG - Intronic
1186460786 X:9746911-9746933 CAGCCTCATGGCCACGGAAGGGG + Intronic
1187367135 X:18675071-18675093 CAAACTCCTCGCCTCGGGGGCGG - Intergenic
1189114306 X:38327388-38327410 CAGCCTCCTGGCCCCGGCGCAGG - Exonic
1193042813 X:77021627-77021649 CAGAATCATGGTCAAGGGGGTGG + Intergenic
1199745994 X:150772244-150772266 GAGACTCCTGATCACGGAGGGGG + Intronic
1200226378 X:154420016-154420038 CCGATTCCTGCCCAGGGGGGAGG - Exonic
1200323075 X:155210330-155210352 CATACTCCTAGCCACTCGGGAGG + Intronic
1202372032 Y:24205345-24205367 CTGGCTCCTTGCCACGGGGCTGG - Intergenic
1202498753 Y:25464771-25464793 CTGGCTCCTTGCCACGGGGCTGG + Intergenic