ID: 1185109934

View in Genome Browser
Species Human (GRCh38)
Location 22:48895159-48895181
Sequence CAGACTCCTGGCCACGGGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 164}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185109926_1185109934 -3 Left 1185109926 22:48895139-48895161 CCATGTGCACCCTCAGGCTTCAG 0: 1
1: 0
2: 7
3: 26
4: 296
Right 1185109934 22:48895159-48895181 CAGACTCCTGGCCACGGGGGCGG 0: 1
1: 0
2: 1
3: 20
4: 164
1185109921_1185109934 22 Left 1185109921 22:48895114-48895136 CCGGCGCCTTCCACCTGGGCAGC 0: 1
1: 0
2: 2
3: 38
4: 298
Right 1185109934 22:48895159-48895181 CAGACTCCTGGCCACGGGGGCGG 0: 1
1: 0
2: 1
3: 20
4: 164
1185109920_1185109934 23 Left 1185109920 22:48895113-48895135 CCCGGCGCCTTCCACCTGGGCAG 0: 1
1: 0
2: 3
3: 18
4: 298
Right 1185109934 22:48895159-48895181 CAGACTCCTGGCCACGGGGGCGG 0: 1
1: 0
2: 1
3: 20
4: 164
1185109919_1185109934 24 Left 1185109919 22:48895112-48895134 CCCCGGCGCCTTCCACCTGGGCA 0: 1
1: 0
2: 0
3: 8
4: 194
Right 1185109934 22:48895159-48895181 CAGACTCCTGGCCACGGGGGCGG 0: 1
1: 0
2: 1
3: 20
4: 164
1185109924_1185109934 9 Left 1185109924 22:48895127-48895149 CCTGGGCAGCTGCCATGTGCACC 0: 1
1: 0
2: 4
3: 31
4: 256
Right 1185109934 22:48895159-48895181 CAGACTCCTGGCCACGGGGGCGG 0: 1
1: 0
2: 1
3: 20
4: 164
1185109922_1185109934 16 Left 1185109922 22:48895120-48895142 CCTTCCACCTGGGCAGCTGCCAT 0: 1
1: 0
2: 3
3: 35
4: 359
Right 1185109934 22:48895159-48895181 CAGACTCCTGGCCACGGGGGCGG 0: 1
1: 0
2: 1
3: 20
4: 164
1185109923_1185109934 12 Left 1185109923 22:48895124-48895146 CCACCTGGGCAGCTGCCATGTGC 0: 1
1: 0
2: 1
3: 38
4: 428
Right 1185109934 22:48895159-48895181 CAGACTCCTGGCCACGGGGGCGG 0: 1
1: 0
2: 1
3: 20
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185109934 Original CRISPR CAGACTCCTGGCCACGGGGG CGG Intergenic