ID: 1185117300

View in Genome Browser
Species Human (GRCh38)
Location 22:48945125-48945147
Sequence TGAGCTGCAGTGGTGCCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185117300_1185117307 4 Left 1185117300 22:48945125-48945147 CCAGCGGGCACCACTGCAGCTCA No data
Right 1185117307 22:48945152-48945174 GGCAGGACCCAGCTGGCGGCTGG No data
1185117300_1185117308 5 Left 1185117300 22:48945125-48945147 CCAGCGGGCACCACTGCAGCTCA No data
Right 1185117308 22:48945153-48945175 GCAGGACCCAGCTGGCGGCTGGG No data
1185117300_1185117306 0 Left 1185117300 22:48945125-48945147 CCAGCGGGCACCACTGCAGCTCA No data
Right 1185117306 22:48945148-48945170 GGCAGGCAGGACCCAGCTGGCGG No data
1185117300_1185117305 -3 Left 1185117300 22:48945125-48945147 CCAGCGGGCACCACTGCAGCTCA No data
Right 1185117305 22:48945145-48945167 TCAGGCAGGCAGGACCCAGCTGG No data
1185117300_1185117309 8 Left 1185117300 22:48945125-48945147 CCAGCGGGCACCACTGCAGCTCA No data
Right 1185117309 22:48945156-48945178 GGACCCAGCTGGCGGCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185117300 Original CRISPR TGAGCTGCAGTGGTGCCCGC TGG (reversed) Intergenic