ID: 1185117303

View in Genome Browser
Species Human (GRCh38)
Location 22:48945135-48945157
Sequence CCTGCCTGCCTGAGCTGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185117303_1185117306 -10 Left 1185117303 22:48945135-48945157 CCACTGCAGCTCAGGCAGGCAGG No data
Right 1185117306 22:48945148-48945170 GGCAGGCAGGACCCAGCTGGCGG No data
1185117303_1185117307 -6 Left 1185117303 22:48945135-48945157 CCACTGCAGCTCAGGCAGGCAGG No data
Right 1185117307 22:48945152-48945174 GGCAGGACCCAGCTGGCGGCTGG No data
1185117303_1185117309 -2 Left 1185117303 22:48945135-48945157 CCACTGCAGCTCAGGCAGGCAGG No data
Right 1185117309 22:48945156-48945178 GGACCCAGCTGGCGGCTGGGAGG No data
1185117303_1185117308 -5 Left 1185117303 22:48945135-48945157 CCACTGCAGCTCAGGCAGGCAGG No data
Right 1185117308 22:48945153-48945175 GCAGGACCCAGCTGGCGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185117303 Original CRISPR CCTGCCTGCCTGAGCTGCAG TGG (reversed) Intergenic