ID: 1185117305

View in Genome Browser
Species Human (GRCh38)
Location 22:48945145-48945167
Sequence TCAGGCAGGCAGGACCCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185117300_1185117305 -3 Left 1185117300 22:48945125-48945147 CCAGCGGGCACCACTGCAGCTCA No data
Right 1185117305 22:48945145-48945167 TCAGGCAGGCAGGACCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185117305 Original CRISPR TCAGGCAGGCAGGACCCAGC TGG Intergenic