ID: 1185117306 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 22:48945148-48945170 |
| Sequence | GGCAGGCAGGACCCAGCTGG CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1185117300_1185117306 | 0 | Left | 1185117300 | 22:48945125-48945147 | CCAGCGGGCACCACTGCAGCTCA | 0: 1 1: 0 2: 0 3: 12 4: 214 |
||
| Right | 1185117306 | 22:48945148-48945170 | GGCAGGCAGGACCCAGCTGGCGG | No data | ||||
| 1185117303_1185117306 | -10 | Left | 1185117303 | 22:48945135-48945157 | CCACTGCAGCTCAGGCAGGCAGG | 0: 1 1: 0 2: 5 3: 65 4: 922 |
||
| Right | 1185117306 | 22:48945148-48945170 | GGCAGGCAGGACCCAGCTGGCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1185117306 | Original CRISPR | GGCAGGCAGGACCCAGCTGG CGG | Intergenic | ||