ID: 1185117306 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 22:48945148-48945170 |
Sequence | GGCAGGCAGGACCCAGCTGG CGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1185117303_1185117306 | -10 | Left | 1185117303 | 22:48945135-48945157 | CCACTGCAGCTCAGGCAGGCAGG | No data | ||
Right | 1185117306 | 22:48945148-48945170 | GGCAGGCAGGACCCAGCTGGCGG | No data | ||||
1185117300_1185117306 | 0 | Left | 1185117300 | 22:48945125-48945147 | CCAGCGGGCACCACTGCAGCTCA | No data | ||
Right | 1185117306 | 22:48945148-48945170 | GGCAGGCAGGACCCAGCTGGCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1185117306 | Original CRISPR | GGCAGGCAGGACCCAGCTGG CGG | Intergenic | ||