ID: 1185117307

View in Genome Browser
Species Human (GRCh38)
Location 22:48945152-48945174
Sequence GGCAGGACCCAGCTGGCGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185117300_1185117307 4 Left 1185117300 22:48945125-48945147 CCAGCGGGCACCACTGCAGCTCA No data
Right 1185117307 22:48945152-48945174 GGCAGGACCCAGCTGGCGGCTGG No data
1185117303_1185117307 -6 Left 1185117303 22:48945135-48945157 CCACTGCAGCTCAGGCAGGCAGG No data
Right 1185117307 22:48945152-48945174 GGCAGGACCCAGCTGGCGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185117307 Original CRISPR GGCAGGACCCAGCTGGCGGC TGG Intergenic