ID: 1185117852

View in Genome Browser
Species Human (GRCh38)
Location 22:48948248-48948270
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185117849_1185117852 12 Left 1185117849 22:48948213-48948235 CCAGTGGGCACGCTGGTGCACAC No data
Right 1185117852 22:48948248-48948270 CAATGCCCATGGATGTCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185117852 Original CRISPR CAATGCCCATGGATGTCCCC TGG Intergenic
No off target data available for this crispr