ID: 1185122791

View in Genome Browser
Species Human (GRCh38)
Location 22:48982563-48982585
Sequence TCCCCACGGAACCGTGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185122791_1185122801 30 Left 1185122791 22:48982563-48982585 CCAGCCTCACGGTTCCGTGGGGA No data
Right 1185122801 22:48982616-48982638 CAAATGAGCCAAGTCTCCCATGG No data
1185122791_1185122793 -10 Left 1185122791 22:48982563-48982585 CCAGCCTCACGGTTCCGTGGGGA No data
Right 1185122793 22:48982576-48982598 TCCGTGGGGACTTGAAAGAGAGG No data
1185122791_1185122795 -9 Left 1185122791 22:48982563-48982585 CCAGCCTCACGGTTCCGTGGGGA No data
Right 1185122795 22:48982577-48982599 CCGTGGGGACTTGAAAGAGAGGG No data
1185122791_1185122800 7 Left 1185122791 22:48982563-48982585 CCAGCCTCACGGTTCCGTGGGGA No data
Right 1185122800 22:48982593-48982615 GAGAGGGGTGAGGGCTGCTTGGG No data
1185122791_1185122796 -8 Left 1185122791 22:48982563-48982585 CCAGCCTCACGGTTCCGTGGGGA No data
Right 1185122796 22:48982578-48982600 CGTGGGGACTTGAAAGAGAGGGG No data
1185122791_1185122799 6 Left 1185122791 22:48982563-48982585 CCAGCCTCACGGTTCCGTGGGGA No data
Right 1185122799 22:48982592-48982614 AGAGAGGGGTGAGGGCTGCTTGG No data
1185122791_1185122798 -2 Left 1185122791 22:48982563-48982585 CCAGCCTCACGGTTCCGTGGGGA No data
Right 1185122798 22:48982584-48982606 GACTTGAAAGAGAGGGGTGAGGG No data
1185122791_1185122797 -3 Left 1185122791 22:48982563-48982585 CCAGCCTCACGGTTCCGTGGGGA No data
Right 1185122797 22:48982583-48982605 GGACTTGAAAGAGAGGGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185122791 Original CRISPR TCCCCACGGAACCGTGAGGC TGG (reversed) Intergenic
No off target data available for this crispr