ID: 1185122793

View in Genome Browser
Species Human (GRCh38)
Location 22:48982576-48982598
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185122791_1185122793 -10 Left 1185122791 22:48982563-48982585 CCAGCCTCACGGTTCCGTGGGGA No data
Right 1185122793 22:48982576-48982598 TCCGTGGGGACTTGAAAGAGAGG No data
1185122781_1185122793 16 Left 1185122781 22:48982537-48982559 CCCCCAGCACTGGGCACAGGCCT No data
Right 1185122793 22:48982576-48982598 TCCGTGGGGACTTGAAAGAGAGG No data
1185122776_1185122793 27 Left 1185122776 22:48982526-48982548 CCACCTCTTTGCCCCCAGCACTG No data
Right 1185122793 22:48982576-48982598 TCCGTGGGGACTTGAAAGAGAGG No data
1185122782_1185122793 15 Left 1185122782 22:48982538-48982560 CCCCAGCACTGGGCACAGGCCTA No data
Right 1185122793 22:48982576-48982598 TCCGTGGGGACTTGAAAGAGAGG No data
1185122784_1185122793 13 Left 1185122784 22:48982540-48982562 CCAGCACTGGGCACAGGCCTAGC No data
Right 1185122793 22:48982576-48982598 TCCGTGGGGACTTGAAAGAGAGG No data
1185122779_1185122793 24 Left 1185122779 22:48982529-48982551 CCTCTTTGCCCCCAGCACTGGGC No data
Right 1185122793 22:48982576-48982598 TCCGTGGGGACTTGAAAGAGAGG No data
1185122783_1185122793 14 Left 1185122783 22:48982539-48982561 CCCAGCACTGGGCACAGGCCTAG No data
Right 1185122793 22:48982576-48982598 TCCGTGGGGACTTGAAAGAGAGG No data
1185122786_1185122793 -4 Left 1185122786 22:48982557-48982579 CCTAGCCCAGCCTCACGGTTCCG No data
Right 1185122793 22:48982576-48982598 TCCGTGGGGACTTGAAAGAGAGG No data
1185122789_1185122793 -9 Left 1185122789 22:48982562-48982584 CCCAGCCTCACGGTTCCGTGGGG No data
Right 1185122793 22:48982576-48982598 TCCGTGGGGACTTGAAAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185122793 Original CRISPR TCCGTGGGGACTTGAAAGAG AGG Intergenic
No off target data available for this crispr