ID: 1185122799

View in Genome Browser
Species Human (GRCh38)
Location 22:48982592-48982614
Sequence AGAGAGGGGTGAGGGCTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185122792_1185122799 2 Left 1185122792 22:48982567-48982589 CCTCACGGTTCCGTGGGGACTTG No data
Right 1185122799 22:48982592-48982614 AGAGAGGGGTGAGGGCTGCTTGG No data
1185122791_1185122799 6 Left 1185122791 22:48982563-48982585 CCAGCCTCACGGTTCCGTGGGGA No data
Right 1185122799 22:48982592-48982614 AGAGAGGGGTGAGGGCTGCTTGG No data
1185122783_1185122799 30 Left 1185122783 22:48982539-48982561 CCCAGCACTGGGCACAGGCCTAG No data
Right 1185122799 22:48982592-48982614 AGAGAGGGGTGAGGGCTGCTTGG No data
1185122786_1185122799 12 Left 1185122786 22:48982557-48982579 CCTAGCCCAGCCTCACGGTTCCG No data
Right 1185122799 22:48982592-48982614 AGAGAGGGGTGAGGGCTGCTTGG No data
1185122794_1185122799 -8 Left 1185122794 22:48982577-48982599 CCGTGGGGACTTGAAAGAGAGGG No data
Right 1185122799 22:48982592-48982614 AGAGAGGGGTGAGGGCTGCTTGG No data
1185122784_1185122799 29 Left 1185122784 22:48982540-48982562 CCAGCACTGGGCACAGGCCTAGC No data
Right 1185122799 22:48982592-48982614 AGAGAGGGGTGAGGGCTGCTTGG No data
1185122789_1185122799 7 Left 1185122789 22:48982562-48982584 CCCAGCCTCACGGTTCCGTGGGG No data
Right 1185122799 22:48982592-48982614 AGAGAGGGGTGAGGGCTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185122799 Original CRISPR AGAGAGGGGTGAGGGCTGCT TGG Intergenic
No off target data available for this crispr