ID: 1185122801

View in Genome Browser
Species Human (GRCh38)
Location 22:48982616-48982638
Sequence CAAATGAGCCAAGTCTCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185122791_1185122801 30 Left 1185122791 22:48982563-48982585 CCAGCCTCACGGTTCCGTGGGGA No data
Right 1185122801 22:48982616-48982638 CAAATGAGCCAAGTCTCCCATGG No data
1185122794_1185122801 16 Left 1185122794 22:48982577-48982599 CCGTGGGGACTTGAAAGAGAGGG No data
Right 1185122801 22:48982616-48982638 CAAATGAGCCAAGTCTCCCATGG No data
1185122792_1185122801 26 Left 1185122792 22:48982567-48982589 CCTCACGGTTCCGTGGGGACTTG No data
Right 1185122801 22:48982616-48982638 CAAATGAGCCAAGTCTCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185122801 Original CRISPR CAAATGAGCCAAGTCTCCCA TGG Intergenic
No off target data available for this crispr