ID: 1185125375

View in Genome Browser
Species Human (GRCh38)
Location 22:49007549-49007571
Sequence TCTGCCGGCCTCTCACATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185125375_1185125381 15 Left 1185125375 22:49007549-49007571 CCTGGATGTGAGAGGCCGGCAGA No data
Right 1185125381 22:49007587-49007609 GGAGCCCAGGAGAGCCAGAGCGG No data
1185125375_1185125380 2 Left 1185125375 22:49007549-49007571 CCTGGATGTGAGAGGCCGGCAGA No data
Right 1185125380 22:49007574-49007596 TGCTAGGGAAGCAGGAGCCCAGG No data
1185125375_1185125379 -6 Left 1185125375 22:49007549-49007571 CCTGGATGTGAGAGGCCGGCAGA No data
Right 1185125379 22:49007566-49007588 GGCAGATGTGCTAGGGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185125375 Original CRISPR TCTGCCGGCCTCTCACATCC AGG (reversed) Intergenic
No off target data available for this crispr