ID: 1185126392

View in Genome Browser
Species Human (GRCh38)
Location 22:49013197-49013219
Sequence TGGGAACTGTGGCCCCACGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185126380_1185126392 26 Left 1185126380 22:49013148-49013170 CCCATGTGCCAGACATCATATGA No data
Right 1185126392 22:49013197-49013219 TGGGAACTGTGGCCCCACGGAGG No data
1185126379_1185126392 27 Left 1185126379 22:49013147-49013169 CCCCATGTGCCAGACATCATATG No data
Right 1185126392 22:49013197-49013219 TGGGAACTGTGGCCCCACGGAGG No data
1185126382_1185126392 18 Left 1185126382 22:49013156-49013178 CCAGACATCATATGACCTATTTT No data
Right 1185126392 22:49013197-49013219 TGGGAACTGTGGCCCCACGGAGG No data
1185126381_1185126392 25 Left 1185126381 22:49013149-49013171 CCATGTGCCAGACATCATATGAC No data
Right 1185126392 22:49013197-49013219 TGGGAACTGTGGCCCCACGGAGG No data
1185126387_1185126392 3 Left 1185126387 22:49013171-49013193 CCTATTTTCTAGGTGGGATTGGT No data
Right 1185126392 22:49013197-49013219 TGGGAACTGTGGCCCCACGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185126392 Original CRISPR TGGGAACTGTGGCCCCACGG AGG Intergenic