ID: 1185129250

View in Genome Browser
Species Human (GRCh38)
Location 22:49028318-49028340
Sequence TGGCAGAGCCAGAGTGGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185129243_1185129250 7 Left 1185129243 22:49028288-49028310 CCTGCCTGGAGGAGTCCAGAGGG No data
Right 1185129250 22:49028318-49028340 TGGCAGAGCCAGAGTGGACAAGG No data
1185129237_1185129250 23 Left 1185129237 22:49028272-49028294 CCTCTCATGTCCTCACCCTGCCT No data
Right 1185129250 22:49028318-49028340 TGGCAGAGCCAGAGTGGACAAGG No data
1185129248_1185129250 -8 Left 1185129248 22:49028303-49028325 CCAGAGGGGCAGAGTTGGCAGAG No data
Right 1185129250 22:49028318-49028340 TGGCAGAGCCAGAGTGGACAAGG No data
1185129241_1185129250 8 Left 1185129241 22:49028287-49028309 CCCTGCCTGGAGGAGTCCAGAGG No data
Right 1185129250 22:49028318-49028340 TGGCAGAGCCAGAGTGGACAAGG No data
1185129236_1185129250 26 Left 1185129236 22:49028269-49028291 CCACCTCTCATGTCCTCACCCTG No data
Right 1185129250 22:49028318-49028340 TGGCAGAGCCAGAGTGGACAAGG No data
1185129234_1185129250 30 Left 1185129234 22:49028265-49028287 CCGCCCACCTCTCATGTCCTCAC No data
Right 1185129250 22:49028318-49028340 TGGCAGAGCCAGAGTGGACAAGG No data
1185129235_1185129250 27 Left 1185129235 22:49028268-49028290 CCCACCTCTCATGTCCTCACCCT No data
Right 1185129250 22:49028318-49028340 TGGCAGAGCCAGAGTGGACAAGG No data
1185129240_1185129250 13 Left 1185129240 22:49028282-49028304 CCTCACCCTGCCTGGAGGAGTCC No data
Right 1185129250 22:49028318-49028340 TGGCAGAGCCAGAGTGGACAAGG No data
1185129246_1185129250 3 Left 1185129246 22:49028292-49028314 CCTGGAGGAGTCCAGAGGGGCAG No data
Right 1185129250 22:49028318-49028340 TGGCAGAGCCAGAGTGGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185129250 Original CRISPR TGGCAGAGCCAGAGTGGACA AGG Intergenic
No off target data available for this crispr