ID: 1185133558

View in Genome Browser
Species Human (GRCh38)
Location 22:49055580-49055602
Sequence AACCCCAGCTTCCAGGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185133558_1185133563 0 Left 1185133558 22:49055580-49055602 CCTGTCTCCTGGAAGCTGGGGTT No data
Right 1185133563 22:49055603-49055625 GATGGGGACCTCCCAACTGCAGG No data
1185133558_1185133564 7 Left 1185133558 22:49055580-49055602 CCTGTCTCCTGGAAGCTGGGGTT No data
Right 1185133564 22:49055610-49055632 ACCTCCCAACTGCAGGCCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185133558 Original CRISPR AACCCCAGCTTCCAGGAGAC AGG (reversed) Intergenic
No off target data available for this crispr