ID: 1185133678

View in Genome Browser
Species Human (GRCh38)
Location 22:49056166-49056188
Sequence TGGGAAGCCCAGGATCATCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185133678_1185133685 30 Left 1185133678 22:49056166-49056188 CCGTGATGATCCTGGGCTTCCCA No data
Right 1185133685 22:49056219-49056241 GTGTTTCAGCCCCCAGTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185133678 Original CRISPR TGGGAAGCCCAGGATCATCA CGG (reversed) Intergenic
No off target data available for this crispr