ID: 1185134509

View in Genome Browser
Species Human (GRCh38)
Location 22:49062155-49062177
Sequence TGCTCCGCAGCCAGCCCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185134508_1185134509 2 Left 1185134508 22:49062130-49062152 CCAGGGATGGGAGCAGACGTGTG No data
Right 1185134509 22:49062155-49062177 TGCTCCGCAGCCAGCCCAGCTGG No data
1185134503_1185134509 20 Left 1185134503 22:49062112-49062134 CCTACATGGGTCTGGACACCAGG No data
Right 1185134509 22:49062155-49062177 TGCTCCGCAGCCAGCCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185134509 Original CRISPR TGCTCCGCAGCCAGCCCAGC TGG Intergenic