ID: 1185137226

View in Genome Browser
Species Human (GRCh38)
Location 22:49079903-49079925
Sequence CTTGGTTGGAAGCCGGGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185137226_1185137245 15 Left 1185137226 22:49079903-49079925 CCTGGGCCCGGCTTCCAACCAAG No data
Right 1185137245 22:49079941-49079963 CGGGAGGCTGGGTTGGGGAGGGG No data
1185137226_1185137248 22 Left 1185137226 22:49079903-49079925 CCTGGGCCCGGCTTCCAACCAAG No data
Right 1185137248 22:49079948-49079970 CTGGGTTGGGGAGGGGAGGAGGG No data
1185137226_1185137238 4 Left 1185137226 22:49079903-49079925 CCTGGGCCCGGCTTCCAACCAAG No data
Right 1185137238 22:49079930-49079952 CCCTGGCTTCTCGGGAGGCTGGG No data
1185137226_1185137242 10 Left 1185137226 22:49079903-49079925 CCTGGGCCCGGCTTCCAACCAAG No data
Right 1185137242 22:49079936-49079958 CTTCTCGGGAGGCTGGGTTGGGG No data
1185137226_1185137234 -4 Left 1185137226 22:49079903-49079925 CCTGGGCCCGGCTTCCAACCAAG No data
Right 1185137234 22:49079922-49079944 CAAGGTCTCCCTGGCTTCTCGGG No data
1185137226_1185137240 8 Left 1185137226 22:49079903-49079925 CCTGGGCCCGGCTTCCAACCAAG No data
Right 1185137240 22:49079934-49079956 GGCTTCTCGGGAGGCTGGGTTGG No data
1185137226_1185137241 9 Left 1185137226 22:49079903-49079925 CCTGGGCCCGGCTTCCAACCAAG No data
Right 1185137241 22:49079935-49079957 GCTTCTCGGGAGGCTGGGTTGGG No data
1185137226_1185137249 23 Left 1185137226 22:49079903-49079925 CCTGGGCCCGGCTTCCAACCAAG No data
Right 1185137249 22:49079949-49079971 TGGGTTGGGGAGGGGAGGAGGGG No data
1185137226_1185137243 13 Left 1185137226 22:49079903-49079925 CCTGGGCCCGGCTTCCAACCAAG No data
Right 1185137243 22:49079939-49079961 CTCGGGAGGCTGGGTTGGGGAGG No data
1185137226_1185137244 14 Left 1185137226 22:49079903-49079925 CCTGGGCCCGGCTTCCAACCAAG No data
Right 1185137244 22:49079940-49079962 TCGGGAGGCTGGGTTGGGGAGGG No data
1185137226_1185137235 -1 Left 1185137226 22:49079903-49079925 CCTGGGCCCGGCTTCCAACCAAG No data
Right 1185137235 22:49079925-49079947 GGTCTCCCTGGCTTCTCGGGAGG No data
1185137226_1185137247 21 Left 1185137226 22:49079903-49079925 CCTGGGCCCGGCTTCCAACCAAG No data
Right 1185137247 22:49079947-49079969 GCTGGGTTGGGGAGGGGAGGAGG No data
1185137226_1185137233 -5 Left 1185137226 22:49079903-49079925 CCTGGGCCCGGCTTCCAACCAAG No data
Right 1185137233 22:49079921-49079943 CCAAGGTCTCCCTGGCTTCTCGG No data
1185137226_1185137246 18 Left 1185137226 22:49079903-49079925 CCTGGGCCCGGCTTCCAACCAAG No data
Right 1185137246 22:49079944-49079966 GAGGCTGGGTTGGGGAGGGGAGG No data
1185137226_1185137236 3 Left 1185137226 22:49079903-49079925 CCTGGGCCCGGCTTCCAACCAAG No data
Right 1185137236 22:49079929-49079951 TCCCTGGCTTCTCGGGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185137226 Original CRISPR CTTGGTTGGAAGCCGGGCCC AGG (reversed) Intergenic
No off target data available for this crispr