ID: 1185138405

View in Genome Browser
Species Human (GRCh38)
Location 22:49086844-49086866
Sequence GCCTCTCCCCGACGGCCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185138405_1185138411 16 Left 1185138405 22:49086844-49086866 CCAGGAGGCCGTCGGGGAGAGGC No data
Right 1185138411 22:49086883-49086905 CACACATGTGTGAGCCAGTCAGG No data
1185138405_1185138408 -10 Left 1185138405 22:49086844-49086866 CCAGGAGGCCGTCGGGGAGAGGC No data
Right 1185138408 22:49086857-49086879 GGGGAGAGGCCGGTGCTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185138405 Original CRISPR GCCTCTCCCCGACGGCCTCC TGG (reversed) Intergenic