ID: 1185138408

View in Genome Browser
Species Human (GRCh38)
Location 22:49086857-49086879
Sequence GGGGAGAGGCCGGTGCTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185138403_1185138408 -9 Left 1185138403 22:49086843-49086865 CCCAGGAGGCCGTCGGGGAGAGG No data
Right 1185138408 22:49086857-49086879 GGGGAGAGGCCGGTGCTGTGTGG No data
1185138405_1185138408 -10 Left 1185138405 22:49086844-49086866 CCAGGAGGCCGTCGGGGAGAGGC No data
Right 1185138408 22:49086857-49086879 GGGGAGAGGCCGGTGCTGTGTGG No data
1185138400_1185138408 -4 Left 1185138400 22:49086838-49086860 CCAGCCCCAGGAGGCCGTCGGGG No data
Right 1185138408 22:49086857-49086879 GGGGAGAGGCCGGTGCTGTGTGG No data
1185138402_1185138408 -8 Left 1185138402 22:49086842-49086864 CCCCAGGAGGCCGTCGGGGAGAG No data
Right 1185138408 22:49086857-49086879 GGGGAGAGGCCGGTGCTGTGTGG No data
1185138395_1185138408 9 Left 1185138395 22:49086825-49086847 CCGTGAGGATGCTCCAGCCCCAG No data
Right 1185138408 22:49086857-49086879 GGGGAGAGGCCGGTGCTGTGTGG No data
1185138394_1185138408 10 Left 1185138394 22:49086824-49086846 CCCGTGAGGATGCTCCAGCCCCA No data
Right 1185138408 22:49086857-49086879 GGGGAGAGGCCGGTGCTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185138408 Original CRISPR GGGGAGAGGCCGGTGCTGTG TGG Intergenic