ID: 1185138411

View in Genome Browser
Species Human (GRCh38)
Location 22:49086883-49086905
Sequence CACACATGTGTGAGCCAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185138409_1185138411 -6 Left 1185138409 22:49086866-49086888 CCGGTGCTGTGTGGAACCACACA No data
Right 1185138411 22:49086883-49086905 CACACATGTGTGAGCCAGTCAGG No data
1185138403_1185138411 17 Left 1185138403 22:49086843-49086865 CCCAGGAGGCCGTCGGGGAGAGG No data
Right 1185138411 22:49086883-49086905 CACACATGTGTGAGCCAGTCAGG No data
1185138400_1185138411 22 Left 1185138400 22:49086838-49086860 CCAGCCCCAGGAGGCCGTCGGGG No data
Right 1185138411 22:49086883-49086905 CACACATGTGTGAGCCAGTCAGG No data
1185138407_1185138411 8 Left 1185138407 22:49086852-49086874 CCGTCGGGGAGAGGCCGGTGCTG No data
Right 1185138411 22:49086883-49086905 CACACATGTGTGAGCCAGTCAGG No data
1185138405_1185138411 16 Left 1185138405 22:49086844-49086866 CCAGGAGGCCGTCGGGGAGAGGC No data
Right 1185138411 22:49086883-49086905 CACACATGTGTGAGCCAGTCAGG No data
1185138402_1185138411 18 Left 1185138402 22:49086842-49086864 CCCCAGGAGGCCGTCGGGGAGAG No data
Right 1185138411 22:49086883-49086905 CACACATGTGTGAGCCAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185138411 Original CRISPR CACACATGTGTGAGCCAGTC AGG Intergenic