ID: 1185140520

View in Genome Browser
Species Human (GRCh38)
Location 22:49098396-49098418
Sequence CAGTATTAGGAGACACCCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185140520_1185140528 22 Left 1185140520 22:49098396-49098418 CCGCAGGGTGTCTCCTAATACTG No data
Right 1185140528 22:49098441-49098463 AATCCAGACAGGACTACGAATGG No data
1185140520_1185140525 11 Left 1185140520 22:49098396-49098418 CCGCAGGGTGTCTCCTAATACTG No data
Right 1185140525 22:49098430-49098452 TACAACAACCCAATCCAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185140520 Original CRISPR CAGTATTAGGAGACACCCTG CGG (reversed) Intergenic
No off target data available for this crispr