ID: 1185140924

View in Genome Browser
Species Human (GRCh38)
Location 22:49100825-49100847
Sequence GCGGAGGCCTTCAGACACCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185140924_1185140930 -8 Left 1185140924 22:49100825-49100847 CCCCGGTGTCTGAAGGCCTCCGC No data
Right 1185140930 22:49100840-49100862 GCCTCCGCGTACCGGGGCTGTGG No data
1185140924_1185140934 2 Left 1185140924 22:49100825-49100847 CCCCGGTGTCTGAAGGCCTCCGC No data
Right 1185140934 22:49100850-49100872 ACCGGGGCTGTGGTTAAGCTGGG No data
1185140924_1185140933 1 Left 1185140924 22:49100825-49100847 CCCCGGTGTCTGAAGGCCTCCGC No data
Right 1185140933 22:49100849-49100871 TACCGGGGCTGTGGTTAAGCTGG No data
1185140924_1185140936 11 Left 1185140924 22:49100825-49100847 CCCCGGTGTCTGAAGGCCTCCGC No data
Right 1185140936 22:49100859-49100881 GTGGTTAAGCTGGGACCAGCAGG No data
1185140924_1185140938 28 Left 1185140924 22:49100825-49100847 CCCCGGTGTCTGAAGGCCTCCGC No data
Right 1185140938 22:49100876-49100898 AGCAGGAAACTCACAAGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185140924 Original CRISPR GCGGAGGCCTTCAGACACCG GGG (reversed) Intergenic
No off target data available for this crispr