ID: 1185141539

View in Genome Browser
Species Human (GRCh38)
Location 22:49105184-49105206
Sequence GGAGCGTTAATGCACCTCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185141539_1185141542 -1 Left 1185141539 22:49105184-49105206 CCATAGAGGTGCATTAACGCTCC No data
Right 1185141542 22:49105206-49105228 CGTAATGCCATCTATTATTTGGG No data
1185141539_1185141541 -2 Left 1185141539 22:49105184-49105206 CCATAGAGGTGCATTAACGCTCC No data
Right 1185141541 22:49105205-49105227 CCGTAATGCCATCTATTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185141539 Original CRISPR GGAGCGTTAATGCACCTCTA TGG (reversed) Intergenic
No off target data available for this crispr