ID: 1185141542

View in Genome Browser
Species Human (GRCh38)
Location 22:49105206-49105228
Sequence CGTAATGCCATCTATTATTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185141539_1185141542 -1 Left 1185141539 22:49105184-49105206 CCATAGAGGTGCATTAACGCTCC No data
Right 1185141542 22:49105206-49105228 CGTAATGCCATCTATTATTTGGG No data
1185141535_1185141542 28 Left 1185141535 22:49105155-49105177 CCCTGAGTAGACACTGCCTTTCA No data
Right 1185141542 22:49105206-49105228 CGTAATGCCATCTATTATTTGGG No data
1185141536_1185141542 27 Left 1185141536 22:49105156-49105178 CCTGAGTAGACACTGCCTTTCAT No data
Right 1185141542 22:49105206-49105228 CGTAATGCCATCTATTATTTGGG No data
1185141538_1185141542 12 Left 1185141538 22:49105171-49105193 CCTTTCATTTATGCCATAGAGGT No data
Right 1185141542 22:49105206-49105228 CGTAATGCCATCTATTATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185141542 Original CRISPR CGTAATGCCATCTATTATTT GGG Intergenic
No off target data available for this crispr