ID: 1185141949

View in Genome Browser
Species Human (GRCh38)
Location 22:49107583-49107605
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185141949_1185141957 27 Left 1185141949 22:49107583-49107605 CCGCACTCCTCCAGTAATTCCTG No data
Right 1185141957 22:49107633-49107655 AGCCCCCGATGTCCCTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185141949 Original CRISPR CAGGAATTACTGGAGGAGTG CGG (reversed) Intergenic
No off target data available for this crispr