ID: 1185146547

View in Genome Browser
Species Human (GRCh38)
Location 22:49140098-49140120
Sequence GGGCATCCAGGGGGACTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185146547_1185146559 10 Left 1185146547 22:49140098-49140120 CCAGGAAGTCCCCCTGGATGCCC No data
Right 1185146559 22:49140131-49140153 CGAGTGAGTTTCCCTCCCTTGGG No data
1185146547_1185146560 11 Left 1185146547 22:49140098-49140120 CCAGGAAGTCCCCCTGGATGCCC No data
Right 1185146560 22:49140132-49140154 GAGTGAGTTTCCCTCCCTTGGGG No data
1185146547_1185146558 9 Left 1185146547 22:49140098-49140120 CCAGGAAGTCCCCCTGGATGCCC No data
Right 1185146558 22:49140130-49140152 GCGAGTGAGTTTCCCTCCCTTGG No data
1185146547_1185146563 24 Left 1185146547 22:49140098-49140120 CCAGGAAGTCCCCCTGGATGCCC No data
Right 1185146563 22:49140145-49140167 TCCCTTGGGGCCCCTCACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185146547 Original CRISPR GGGCATCCAGGGGGACTTCC TGG (reversed) Intergenic
No off target data available for this crispr