ID: 1185146702

View in Genome Browser
Species Human (GRCh38)
Location 22:49141123-49141145
Sequence GGGCCTCTGGTCAGCCCTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185146696_1185146702 2 Left 1185146696 22:49141098-49141120 CCTGGATGGTGTCTGCGGCAGAA No data
Right 1185146702 22:49141123-49141145 GGGCCTCTGGTCAGCCCTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185146702 Original CRISPR GGGCCTCTGGTCAGCCCTAG GGG Intergenic
No off target data available for this crispr